Anthyllis vulneraria
speciesAt a glance
Occurrence records271 390
Data sources13
Biological traits53
DNA specimens62
eDNA detections86
Sources13 archives
Databases and archives Anthyllis vulneraria's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility271 390 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI86 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics62 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources53 traits
Chemical compositionLOTUS11 compounds
Occurrence & distributionGBIF271 390 records
Environmental DNA3 datasets · 8 countries86 detections
DNA & barcodingBOLD · NCBI62 specimens
Genome at a glanceCCDB · GoaT · NCBI421 Mbp
01Narrative
L'Anthyllide vulnéraire est une espèce de plantes à fleurs de la famille des Fabacées (Légumineuses). C'est une plante herbacée trouvée en Europe, en Afrique du Nord et en Asie de l'Ouest. C'est une plante médicinale.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology16
Fruit length3 mm
Leaf length23.5 mm
Leaf length max31 mm
Leaf mass63.29 mg
Leaf size212 mm²
⚠ sources differ — TRY: 212 mm² · LEDA: 1 007 mm² · GIFT: 1 007 mm²
Leaf width5.5 mm
Plant height0.275 m
⚠ sources differ — GIFT: 0.275 m · AusTraits: 0.7 m · LEDA: 0.2 m · TRY: 0.059 m
Plant height generative0.154 m
Plant height max1 m
Plant height min0.05 m
Seed length2.32 mm
⚠ sources differ — TRY: 2.32 mm · AusTraits: 2 mm · GIFT: 1.5 mm
Seed length max1.5 mm
Seed length min1.5 mm
Seed mass3.15 mg
⚠ sources differ — TRY: 3.15 mg · LEDA: 3.28 mg · GIFT: 2.83 mg
Seed mass max4.51 mg
Seed mass min1.96 mg
Life cycle & reproduction14
Deciduousnessevergreen
⚠ sources differ — TRY: evergreen · GIFT: deciduous
Dehiscencedehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: epizoochor · GIFT: anemochorous
Flowering endAug
Flowering startMay
Life formannual or perennial
Life spanperennial
Lifespan years5 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number30
Self fertilizationabsent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment11
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Fruit typelegume
⚠ sources differ — AusTraits: legume · GIFT: capsule
Growth formherb
Habitat GIFTalpine meadows and pastures
Leaf compoundnesscompound
Leaf shapeelliptical lanceolate ovate
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry8
Leaf C:N ratio16.02 g/g
Leaf c431 mg/g
Leaf dry-matter content (LDMC)174 mg/g
Leaf n28.99 mg/g
Leaf p1.31 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)14.52 mm²/mg
⚠ sources differ — TRY: 14.52 mm²/mg · LEDA: 15.9 mm²/mg · GIFT: 16.27 mm²/mg
Other traits2
Diaspore typeone-seeded generative dispersule
Shoot orientationascending
03Chemical composition11 compounds
Compounds documented for Anthyllis vulneraria across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile2 classes
Flavonols9
Isoflavanones2
Documented compounds11 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| 3,4',7-Trihydroxyflavone | present | LOTUS | |
| 5,7-dihydroxy-2-(4-hydroxy-3-methoxyphenyl)-3-[(2S,3R,4R,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one | present | LOTUS | |
| Demethylvestitol | present | LOTUS | |
| Fisetin | present | LOTUS | |
| Geraldol | present | LOTUS | |
| Isorhamnetin | present | LOTUS | |
| Isorhamnetin 3-O-b-D-glucopyranoside | present | LOTUS | |
| Isovestitol | present | LOTUS | |
| Kaempferol | present | LOTUS | |
| Quercetin | present | LOTUS |
05DNA & barcoding62 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthyllis vulneraria has left across the world's sequence archives.
At a glance
DNA specimens62
Marker genes8
GenBank sequences10
eDNA detections86
Countries8
The DNA barcodea real sequence read deposited for this species
GTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCGGAGGGCACGTCTGCCTGGGTGTCACACATCGTTGCCCCAAC …
Anthyllis vulneraria subsp. gandogeri voucher PLT.0528 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL5★rbcLa★trnL-F★ITS4★ITS1★ITS2cp-trnL-intron
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Anthyllis vulneraria carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size420 540 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Anthyllis vulneraria0.42 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 12 n = 6
Ploidy2× diploid · measured
Chromosome records10–142n range12median12mode119records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 12117×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +23
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — CORTI R. - 1931. Osservazioni cariologiche su alcune Leguminosae. Rendiconti delle sedute e brevi comunicazioni.. N. Giorn. Bot. Ital., n.s. , 38: 230.
CCDB · ita-fl — LARSEN K., LAEGAARD S. - 1971. Chromosome studies of the sicilian flora.. Bot. Tidsskr. , 66(3): 249-268.
CCDB · ita-fl — NAPOLI M., ZIZZA A. - 1984. Numeros cromosomticos de plantas occidentales, 270-279.. Anales Jard. Bot. Madrid , 40(2): 451-455.
CCDB · ita-fl — LOEVE A., LOEVE D. - 1982. IOPB chromosome number reports LXXVI.. Taxon , 31(3): 583-587.
CCDB · ita-fl — TAMMARO F. - 1984. Identification and characterization of "Anthyllis vulneraria" L. var. "nana" Ten. (Leguminosae), an endemic plant of central Apennines.. Ann. Bot. (Rome) , 42: 21-28.
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.
CCDB · brit-fl — Larsen, K. Bot. Not. 108: 263-275 (1955)
CCDB · brit-fl — Dempsey, R.E., Gornall, R.J., Bailey, J.P. Watsonia 20: 63-66 (1994)
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae Fernandes, A. & M. F. Santos.Bol. Soc. Brot. ser. 245: 177-225(1971).
CCDB · iber-fl — Estudios cariolgicos en especies espaolas de Anthyllis L. II. Estudio de los cariotipos. Fernndez Piqueras, J. & A. Saudo.Anales Jard. Bot. Madrid36: 321-337(1980).
CCDB · iber-fl — IOPB. Chromosome number reports. LIV. Fernndez Piqueras, J.Taxon25(5/6): 641-642(1976).
CCDB · iber-fl — Aportaciones al conocimiento cariolgico de la tribu Loteae (Fabaceae). Vioque, J. & J. Pastor.Lazaroa12: 9-19(1991).
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. IX. Cruciferae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 252: 79-164(1978).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae, suppl. 1 Fernandes, A. & M. F. Santos.Bol. Soc. Brot. ser. 249: 173-196(1975).
CCDB · iber-fl — Cytotaxonomy of spanish plants. IV.-Dicotyledons: Caesalpinacea-Asteracea. Lve, A. & E. Kjellqvist.Lagascalia4(2): 153-211(1974).
CCDB · iber-fl — Studies on the flora of the Balearic Islands, I. Dahlgren, R., Th. Karlsson & P. Lassen.Bot. Not.124: 249-269(1971).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2874
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2875
CCDB · fl-europaea — Baksay, 1956
CCDB · fl-europaea — Jalas, 1950
CCDB · poland — Skali?ska M., Czapik R., Piotrowicz M. et al. 1959. Further studies in chromosome numbers of Polish Angiosperms (Dicotyledons). Acta Soc. Bot. Pol. 28, 487-529.
CCDB · mediterranean
CCDB · book-ipcn65 — Koi'ugharov & K. 1965b
CCDB · ipcn-api-dl — Yeh, M. S., H. YUASA & F. Maekawa. 1986. Chromosome numbers in the Leguminosae. Sci. Rep. Res. Inst. Evol. Biol. 3: 57–71.
CCDB · ipcn-api-dl — Sekovski, Z. & M. Jovanovska. 1983. Chromosome atlas of some Macedonian angiosperms. IV. Ann. Fac. Biol. Univ. Skopje. 36: 73–86.
CCDB · ipcn-api-dl — Afzal-Raf;auu, Z., J. Vianot, M. Ramade & M. P. Bourreil. 1985. Analyses des charactères caryologiques et écologiques de quelques taxons dans les massifs du Lubéron, de Lure et du Mont-Ventoux. Rev. Cytol. Biol. Veg. Bot. 8: 33–62.
CCDB · ipcn-api-dl — Baltisberger, M. & W. Huber. 1987. Chromosome number report. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 9: 4–5.
CCDB · ipcn-api-dl — Druskovic, B. & M. Lovka. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 15–19.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — LOON VAN, J. C. & H. D. JONG. 1978. In IOPB chromosome number reports LIX. Taxon 27: 53–61.
CCDB · ipcn-api-dl — FERNANDEZ PIQUERAS, J. 1976. In IOPB chromosome number reports LIV. Taxon 25: 631–649.
CCDB · ipcn-api-dl — Magulaev, A. J. 1980. Chromosome numbers of some Fabaceae in the North Caucasus. Bot. Zhurn. 65 (6): 836–843.
CCDB · ipcn-api-dl — Fernandes, A. & M. QUEIROS. 1978. Contribution à la connaissance cytotaxinomique des Spermatophyta du Portugal. IV. Leguminosee (Suppl. 3). Bol. Soc. Brot., sér. 2 52: 79–164.
CCDB · ipcn-api-dl — Papanicolaou, K. 1984. Chromosome Number Reports LXXXII. Taxon 33: 126–134.
CCDB · ipcn-api-dl — Franzen, R. & L. A. Gustavsson. 1983. Chromosome numbers in flowering plants from the high mountains of Sterea Ellas, Greece. Willdenowia 13: 101–106.
CCDB · ipcn-api-dl — Dobea, C. & B. Hahn. 1997. IOPB chromosome data 11. Newslett. Int. Organ. Pl. Biosyst. (Oslo) 26/27: 15–18.
+59 more references
2n 101×CCDB · book-ipcn67-71
CCDB · book-ipcn67-71 — CHUXANOVA, N.A. 1967. Chromosome numbers of some species of Leguminosae Juss. indigenous to the U.S.S.R. (In Russian). Bot. Zhur. 52: 1124-1131.
2n 141×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Tischler, G. (1950). Die chromosomenzhalen der GefäBpflanzen Mitteleuropas. s'-Gravenhage: W. Junk. 263
n 68×CCDB · ita-fl · CCDB · iber-fl · CCDB · ipcn-api-dl +2
CCDB · ita-fl — CORTI R. - 1931. Osservazioni cariologiche su alcune Leguminosae. Rendiconti delle sedute e brevi comunicazioni.. N. Giorn. Bot. Ital., n.s. , 38: 230.
CCDB · iber-fl — IOPB. Chromosome number reports. LIV. Fernndez Piqueras, J.Taxon25(5/6): 641-642(1976).
CCDB · ipcn-api-dl — FERNANDEZ PIQUERAS, J. 1976. In IOPB chromosome number reports LIV. Taxon 25: 631–649.
CCDB · ipcn-api-dl — De Montmollin, B. 1984. Etude cytotaxonomique de la flore de la Crète. II. Nombres chromosomiques. Bot. Helv. 94: 261–267.
CCDB · book-ipcn75-78 — Fernandez Piqueras 1976
CCDB · CromoCat 2015 — Fernández Piqueras, J. (1976). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LIV]. Taxon 25(5/6): 641-642.
CCDB · CromoCat 2015 — Vioque, J. & J. Pastor. (1991). Aportaciones al conocimiento cariológico de la tribu Loteae (Fabaceae). Lazaroa 12: 9-19.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness98% BUSCO
08Occurrence & distribution
Record type271 390 records
Wild obs. + sensor259 413
Museum / vouchered10 373
Cultivated / captive76
Other1 528
Origin
Native13 296
Introduced181
Range
Area of Occupancy AOO281 592 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy41% within 1 km
≤100 m 62 269≤1 km 25 129≤10 km 125 618>10 km 1 771
214 787 georeferenced · 44 626 without coordinates
Open the mapobservation + sensor259 413
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy43% within 1 km
≤100 m 1 004≤1 km 1 928≤10 km 3 600>10 km 281
6 813 georeferenced · 3 560 without coordinates
Open the institutions mapphysical evidence10 373
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy13% within 1 km
≤1 km 3≤10 km 7>10 km 13
23 georeferenced · 53 without coordinates
Open the mapnot free-living76
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions99 of 196 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 3 108 |
| LDlocation not on record | 613 |
| Salzburg, AT | 340 |
| DBF-NHMDlocation not on record | 329 |
| South Kensington, GB | 316 |
| València, ES | 191 |
| Helsinki, FI | 186 |
| Olocation not on record | 184 |
| Oskarshamn, SE | 160 |
| KMNlocation not on record | 159 |
| Brussel, BE | 159 |
| Tartu, EE | 156 |
| Adam Mickiewicz University in Poznańlocation not on record | 153 |
| MAlocation not on record | 142 |
| MeiseBGlocation not on record | 138 |
| BFLlocation not on record | 129 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 121 |
| GZUlocation not on record | 115 |
| Zürich, CH | 111 |
| Vitoria, ES | 104 |
| Zürich, CH | 95 |
| Uppsala, SE | 85 |
| Oulu, FI | 84 |
| Moscow State Universitylocation not on record | 83 |
| Philadelphia, US | 80 |
| Garðabær, IS | 75 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 73 |
| BRNUlocation not on record | 71 |
| Barcelona, ES | 61 |
| Trondheim, NO | 56 |
| Görlitz, DE | 56 |
| BClocation not on record | 56 |
| Wlocation not on record | 54 |
| Bern, CH | 54 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 54 |
| Bergen, NO | 49 |
| BDBClocation not on record | 48 |
| SLU Artdatabankenlocation not on record | 48 |
| TROMlocation not on record | 48 |
| GJOlocation not on record | 46 |
| CICYTEXlocation not on record | 44 |
| Provincia di Livornolocation not on record | 43 |
| CJBGlocation not on record | 38 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 36 |
| Kuopio, FI | 34 |
| Entomological Society of Latvialocation not on record | 31 |
| Pamplona, ES | 26 |
| TUR-Alocation not on record | 26 |
| BIO-UNIPIlocation not on record | 26 |
| Karlsruhe, DE | 25 |
| Madrid, ES | 23 |
| Tallinn, EE | 22 |
| PRClocation not on record | 22 |
| Uniwersytet Warszawskilocation not on record | 21 |
| Saint Louis, US | 21 |
| Salamanca, ES | 19 |
| Dresden, DE | 19 |
| Bronx, US | 18 |
| Turku, FI | 18 |
| Porrentruy, CH | 18 |
| College of the Atlantic, Museumlocation not on record | 18 |
| Berlin, DE | 17 |
| LfUlocation not on record | 17 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 17 |
| Museo Entomologico de Leonlocation not on record | 17 |
| Natural History Museum Rotterdamlocation not on record | 17 |
| Frankfurt am Main | 15 |
| SWlocation not on record | 13 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 12 |
| UIBlocation not on record | 12 |
| SVK001location not on record | 12 |
| Pamplona, ES | 12 |
| Santiago de Compostela, ES | 11 |
| SZUlocation not on record | 10 |
| Forssa, FI | 10 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 10 |
| 10 | |
| Tromso University Museumlocation not on record | 10 |
| Sevilla, ES | 10 |
| US | 9 |
| Frauenfeld, CH | 9 |
| Tilburg, NL | 9 |
| Jyväskylä, FI | 9 |
| Córdoba, ES | 9 |
| Porvoo, FI | 8 |
| Philadelphia, US | 8 |
| Uniwersytet Śląski w Katowicachlocation not on record | 8 |
| Mlocation not on record | 8 |
| Kew, GB | 8 |
| POL003location not on record | 7 |
| Christchurch, NZ | 7 |
| CZE096location not on record | 7 |
| Canberra, AU | 7 |
| Lausanne, CH | 6 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 6 |
| NMBU:MINAlocation not on record | 6 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 6 |
| Bloomington, US | 5 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 5 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 5 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 5 |
| Taipei, TW | 5 |
| Bourges, FR | 5 |
| Denver, US | 5 |
| Chongqing Museumlocation not on record | 5 |
| Glarus, CH | 5 |
| Dhaka, BD | 5 |
| Fulda, DE | 5 |
| Hobart, AU | 5 |
| Sion, CH | 5 |
| Museo Achille Folettolocation not on record | 5 |
| Canadian Department of Agriculturelocation not on record | 4 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 4 |
| John May Museum of Natural Historylocation not on record | 4 |
| BSBIlocation not on record | 4 |
| Granada, ES | 4 |
| Monastir, TN | 4 |
| H-Schuhwlocation not on record | 4 |
| Uniwersytet Opolskilocation not on record | 4 |
| Nijmegen, NL | 4 |
| National Museum Waleslocation not on record | 4 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 4 |
| Stockholm, SE | 3 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 3 |
| nbflocation not on record | 3 |
| Burlington, US | 3 |
| HUN003location not on record | 3 |
| SVN019location not on record | 3 |
| Porto Alegre, BR | 3 |
| Tula State Universitylocation not on record | 3 |
| Pullman, US | 3 |
| Jaén, ES | 3 |
| Badajoz, ES | 3 |
| UoB-IBlocation not on record | 3 |
| Göteborg, SE | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Phyletisches Museum Jenalocation not on record | 3 |
| Beijing, CN | 2 |
| Podgorica, ME | 2 |
| WINlocation not on record | 2 |
| JBSlocation not on record | 2 |
| No collectionlocation not on record | 2 |
| New Haven, US | 2 |
| Wellington, NZ | 2 |
| UGentlocation not on record | 2 |
| Alicante, ES | 2 |
| Columbia, US | 2 |
| ESP109location not on record | 2 |
| San Sebastián, ES | 2 |
| Saint John, CA | 2 |
| Boumlocation not on record | 2 |
| SNSNMClocation not on record | 2 |
| University of New Hampshirelocation not on record | 2 |
| Xiamen, CN | 2 |
| ROM007location not on record | 2 |
| SWE054location not on record | 2 |
| H-AkrKGlocation not on record | 2 |
| Namur, BE | 2 |
| Clemson, US | 1 |
| Rovaniemi, FI | 1 |
| Tuscaloosa, US | 1 |
| Québec, CA | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| Durham, US | 1 |
| European Distributed Institute of Taxonomy (EDIT)location not on record | 1 |
| Gijón, ES | 1 |
| ESP003location not on record | 1 |
| AZE015location not on record | 1 |
| Rishon Le Zion, IL | 1 |
| Banyoles, ES | 1 |
| Davenport, US | 1 |
| Parkville, AU | 1 |
| STUlocation not on record | 1 |
| Museum of the Rockieslocation not on record | 1 |
| Auckland, NZ | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| OLAlocation not on record | 1 |
| NMWlocation not on record | 1 |
| Dekalb, US | 1 |
| Coimbra, PT | 1 |
| Bangkok, TH | 1 |
| Sede di Via Giorgio La Pira del Museo di Storia naturale di Firenze | Via Giorgio La Pira headquarter of the Natural History Museum in Florencelocation not on record | 1 |
| Logan, US | 1 |
| ZRC-SAZUlocation not on record | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Oswego, US | 1 |
| Citadel Hill, GB | 1 |
| San Francisco, US | 1 |
| ESP145location not on record | 1 |
| UniKSlocation not on record | 1 |
| Chicago, US | 1 |
| EL PASO, US | 1 |
| BG-NMNHSlocation not on record | 1 |
| CBDClocation not on record | 1 |
| Flagstaff, US | 1 |
| Tsukuba, JP | 1 |
196 institutions · 9 346 of 10 373 vouchered records shown · 930 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA86 detections
Where the DNA of Anthyllis vulneraria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found86
Studies independent surveys3
Countries8
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 86 detections have coordinates
Open the map8 countries0
in short turf at edge of beachClover field.Palearctic
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median11.5 °C 11.4–13.9
Seasonal swing summer↔winter19.5 °C
Max temp (day)16.0 °C 13.7–16.0
Min temp (night)5.70 °C 5.70–11.7
Precipitation294 mm/mo 62.7–294
Air humidity62.1 % 61.7–63.2
Moisture balance164 mm/mo -42.6–164
Vapour deficit515 Pa 515–584
Wind speed3.30 m/s 2.70–6.40
Cloud cover35.8 % 35.8–61.4
CHELSA 1981–2010, ~9 km grid, at location & month of 79 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.