Anthyllis cytisoides

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Anthyllis

At a glance

Occurrence records79 406

Data sources11

Biological traits18

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Anthyllis cytisoides's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility79 406 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources18 traits

Occurrence & distributionGBIF79 406 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 14

01Narrative

Anthyllis cytisoides is a summer-deciduous shrub of Southern Europe, common in the Balearic Islands and the southeastern coast of the Iberian Peninsula. It prefers semi-arid limestone soils in areas free of frost the year round.Photosynthetic rate and canopy development in the drought-deciduous shrub Anthyllis cytisoides L.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology4

Plant height0.687 m

Seed mass2.62 mg

⚠ sources differ — TRY: 2.62 mg · GIFT: 2.8 mg

Seed mass max3.43 mg

Seed mass min2.17 mg

Life cycle & reproduction6

Deciduousnessevergreen

Dispersal typeself

Life formshrub

Life spanperennial

Lifeform raunkiaer detailednanophanerophyte

Lifespan years8.5 years

Habitat & environment6

Climatesubtropical

Elevation mean671 m

Fruit fleshinessdry

Growth formshrub

Mycorrhiza typearbuscular

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Specific leaf area (SLA)8.31 mm²/mg

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthyllis cytisoides has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences4

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAJ512931.1 ↗211 bpSpain

ACGT

CATCGTTGCCCCAACACCAGCCGCCTCGTGCTGCTTGGTGCGTCGGGCGAATGCTGACATCCCGTGAGCCACGCCTCACGGTTTGTTGAA …

Anthyllis cytisoides internal transcribed spacer 2 (ITS2)

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Anthyllis cytisoides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–142n range14median14mode18records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1418×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn72 +3

CCDB · iber-fl — Aportaciones al conocimiento cariolgico de la tribu Loteae (Fabaceae). Vioque, J. & J. Pastor.Lazaroa12: 9-19(1991).

CCDB · iber-fl — Estudios cariolgicos en especies espaolas de Anthyllis L. II. Estudio de los cariotipos. Fernndez Piqueras, J. & A. Saudo.Anales Jard. Bot. Madrid36: 321-337(1980).

CCDB · iber-fl — IOPB. Chromosome number reports. LIV. Fernndez Piqueras, J.Taxon25(5/6): 641-642(1976).

CCDB · iber-fl — IOPB. Chromosome number reports. LXXIX. Luque, T., C. Romero & J. A. Devesa.Taxon32(2): 321(1983).

CCDB · iber-fl — IOPB. Chromosome number reports. XXXVII. Guinochet, M. & M. Lefranc.Taxon21(4): 497(1972).

CCDB · ipcn-api-dl — Luque, T., C. Romero & J. A. Devesa. 1983. In IOPB chromosome number reports LXXIV. Taxon 32: 321.

CCDB · ipcn-api-dl — Vioque, J. & J. Pastor. 1991. Aportaciones al conocimiento cariológico de la tribu Loteae (Fabaceae). Lazaroa 12: 9–19.

CCDB · ipcn-api-dl — FERNANDEZ PIQUERAS, J. 1976. In IOPB chromosome number reports LIV. Taxon 25: 631–649.

CCDB · book-ipcn72 — GUINOCHET, M., & M LEFRANC. 1972. In IOPB chromosome number reports XXXVII. Taxon 21: 495-500.

CCDB · book-ipcn75-78 — Fernandez Piqueras 1976

CCDB · book-ipcn73-74 — COUDERC, H. 1974. In IOPB chromosome number reports XLIII. Taxon 23 193-196.

CCDB · CromoCat 2015 — Couderc, H. (1974). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLIII]. Taxon 23(1): 193.

CCDB · CromoCat 2015 — Fernández Piqueras, J. & Sañudo, A. (1980). Estudios cariológicos en especies españolas de Anthyllis L. II. Estudio de los cariotipos. Anales Jard. Bot. Madrid 36: 321-337.

CCDB · CromoCat 2015 — Fernández Piqueras, J. (1976). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LIV]. Taxon 25(5/6): 641-642.

CCDB · CromoCat 2015 — Fernández Piqueras, J. (1979). Études caryologiques dans des espèces espagnoles du genre Anthyllis L. Note préliminaire. Webbia 34: 489-496.

CCDB · CromoCat 2015 — Guinochet, M. & Lefranc, M. (1972). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXXVII]. Taxon 21(4): 497.

CCDB · CromoCat 2015 — Luque, T., Romero Zarco, C. & Devesa Alcaraz, J. A. (1983). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXIX]. Taxon 32(2): 321.

CCDB · CromoCat 2015 — Vioque, J. & J. Pastor. (1991). Aportaciones al conocimiento cariológico de la tribu Loteae (Fabaceae). Lazaroa 12: 9-19.

n 77×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · CromoCat 2015

CCDB · iber-fl — Estudios cariolgicos en especies espaolas de Anthyllis L. I. Nmero y comportamiento de los cromosmas en meiosis. Fernndez Piqueras, J. & A. Saudo.Anales Inst. Bot. Cavanilles35: 395-410(1978).

CCDB · iber-fl — IOPB. Chromosome number reports. LIV. Fernndez Piqueras, J.Taxon25(5/6): 641-642(1976).

CCDB · ipcn-api-dl — FERNANDEZ PIQUERAS, J. 1979. Etudes caryologiques dans des especes espagnoles du genre Anthyllis L. Note preliminaire. Webbia 34: 489–496.

CCDB · ipcn-api-dl — FERNANDEZ PIQUERAS, J. 1976. In IOPB chromosome number reports LIV. Taxon 25: 631–649.

CCDB · CromoCat 2015 — Fernández Piqueras, J. & Sañudo, A. (1978). Estudios cariológicos en especies españolas de Anthyllis L. I. Número y comportamiento de los cromosómas en meiosis. Anales Inst. Bot. Cavanilles 35: 395-410.

CCDB · CromoCat 2015 — Fernández Piqueras, J. (1976). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LIV]. Taxon 25(5/6): 641-642.

CCDB · CromoCat 2015 — Fernández Piqueras, J. (1979). Études caryologiques dans des espèces espagnoles du genre Anthyllis L. Note préliminaire. Webbia 34: 489-496.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type79 406 records

Wild obs. + sensor78 431

Museum / vouchered916

Cultivated / captive2

Other57

Origin

Native5 704

Range

Area of Occupancy AOO22 988 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 67 873≤1 km 5 926≤10 km 2 365>10 km 28

76 192 georeferenced · 2 239 without coordinates

Open the mapobservation + sensor78 431

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 24≤1 km 244≤10 km 220>10 km 4

492 georeferenced · 424 without coordinates

Open the institutions mapphysical evidence916

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions28 of 54 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MAlocation not on record	159
València, ES	114
Barcelona, ES	53
LDlocation not on record	49
BClocation not on record	48
Granada, ES	43
Alicante, ES	42
Phyletisches Museum Jenalocation not on record	36
College of the Atlantic, Museumlocation not on record	28
Jaén, ES	25
Museo della Bonifica di San Donà di Piavelocation not on record	23
BDBClocation not on record	19
Salamanca, ES	17
Córdoba, ES	17
Madrid, ES	16
Entomological Society of Latvialocation not on record	16
Wlocation not on record	16
UIBlocation not on record	15
Sevilla, ES	13
EEZA-CSIClocation not on record	11
Universidad del Pais Vasco (UPV/EHU)location not on record	11
Vitoria, ES	11
San Jose State University, Museum of Birds and Mammalslocation not on record	10
CICYTEXlocation not on record	10
Badajoz, ES	9
San Sebastián, ES	6
South Kensington, GB	5
Santiago de Compostela, ES	5
Institut und Museum fuer Geologie und Palaeontologielocation not on record	5
Dresden, DE	4
Madrid, ES	4
MeiseBGlocation not on record	4
JBSlocation not on record	3
Bourges, FR	3
Saint Louis, US	3
Museo Achille Folettolocation not on record	3
ESP145location not on record	2
John May Museum of Natural Historylocation not on record	2
GJOlocation not on record	2
Henry Brockhouse Collectionlocation not on record	2
Oskarshamn, SE	1
Porto Alegre, BR	1
Tilburg, NL	1
Pamplona, ES	1
BIO-UNIPIlocation not on record	1
Uppsala, SE	1
Gijón, ES	1
Canadian Department of Agriculturelocation not on record	1
Bloomington, US	1
Adam Mickiewicz University in Poznańlocation not on record	1
Kew, GB	1
Berlin, DE	1
Arequipa, PE	1
BRNUlocation not on record	1

54 institutions · 878 of 916 vouchered records shown · 38 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Anthyllis cytisoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthyllis cytisoides

At a glance

Sources11 archives

Size & morphology4

Life cycle & reproduction6

Habitat & environment6

Physiology & chemistry2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type79 406 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions28 of 54 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type79 406 records