Anthus richardi

Vieillot, 1818 · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Passeriformes/Motacillidae/Anthus

At a glance

Occurrence records84 900

Data sources9

Biological traits29

DNA specimens7

eDNA detections0

Sources9 archives

Databases and archives Anthus richardi's data was compiled from.

WikipediaWikimedia Foundation15 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility84 900 records↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources29 traits

Occurrence & distributionGBIF84 900 records

DNA & barcodingBOLD7 specimens

Genome at a glanceGoaT · NCBI≈1.1 Gbp

01Narrative

Richard's pipit (Anthus richardi) is a medium-sized passerine bird which breeds in open grasslands in the East Palearctic. It is a long-distance migrant moving to open lowlands in the Indian subcontinent and Southeast Asia. It is a rare but regular vagrant to western Europe. The genus name Anthus is the Latin name for a small bird of grasslands. The English name and richardi are for the French naturalist Charles Richard (1745–1835), director of postal services at Lunéville and friend of Francois Levaillant. It belongs to the pipit genus Anthus in the family Motacillidae. It was formerly lumped together with the Australasian, African, mountain and paddyfield pipits in a single species: Richard's pipit, Anthus novaeseelandiae. These pipits are now commonly considered to be separate species although the African and paddyfield pipits are sometimes treated as part of A. richardi.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBEltonTraitsAVONET

Size & morphology13

Beak depth4.3 mm

Beak length (culmen)18 mm

Beak length (nares)11.3 mm

Beak width4 mm

Body mass27.5 g

⚠ sources differ — AmnioteDB: 27.5 g · AVONET: 32.17 g · EltonTraits: 32.17 g

Body mass (female)31.6 g

Body mass (male)33.3 g

Hand-wing index29.3

Kipp's distance26.6 mm

Secondary length64.3 mm

Tail length71.6 mm

Tarsus length29.2 mm

Wing length92 mm

Life cycle & reproduction7

Age at sexual maturity363 days

Egg mass3.05 g

Fledging age15 days

Incubation14 days

Litter size3.5

Litters per year2.5 /year

Max. longevity65.0 months

Diet & foraging5

Ground100 %

Invertebrate70 %

Seed30 %

Trophic levelcarnivore

Trophic nicheInvertivore

Habitat & environment4

HabitatGrassland

Migration3.0

Primary lifestyleTerrestrial

Range size13 319 039 km²

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthus richardi has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P664 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

120Cmostly conserved

195Tmostly conserved

258Amostly conserved

345Amostly conserved

387Tmostly conserved

444Cmostly conserved

519Amostly conserved

GGAATAGTAGGTACCGCCCTAAGCCTTCTCATCCGAGCAGAACTAGGCCAACCAGGAGCCCTTCTAGGAGACGACCAAGTCTACAACGTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.30%

Haplotypes5

BIN1

Most divergent pair0.60%

AsiaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthus leucophryssame genus1.7%Anthus novaeseelandiaesame genus4.7%Anthus similissame genus5.9%Anthus godlewskiisame genus7.5%Anthus berthelotiisame genus7.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_041109 ↗ · 13 protein · 22 tRNA · 2 rRNA

NADH dehydrogenase subunit 1NADH dehydrogenase subunit 2cytochrome c oxidase subunit Icytochrome c oxidase subunit IIATP synthase F0 subunit 8ATP synthase F0 subunit 6cytochrome c oxidase subunit IIINADH dehydrogenase subunit 3NADH dehydrogenase subunit 4LNADH dehydrogenase subunit 4NADH dehydrogenase subunit 5cytochrome bNADH dehydrogenase subunit 612S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Anthus richardi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 127 834 220 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Anthus richardi1.13 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

07Deep time~4.89 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin4.89 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type84 900 records

Wild obs. + sensor84 678

Museum / vouchered209

Other13

Origin

Native30

Range

Area of Occupancy AOO41 180 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy52% within 1 km

≤100 m 2 927≤1 km 9 586≤10 km 11 590>10 km 156

24 259 georeferenced · 60 419 without coordinates

Open the mapobservation + sensor84 678

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤1 km 12≤10 km 43>10 km 1

56 georeferenced · 153 without coordinates

Open the institutions mapphysical evidence209

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NSMKlocation not on record	52
Seattle, US	27
Ann Arbor, US	21
CPMMlocation not on record	20
NHMOlocation not on record	15
SNSDlocation not on record	13
Edmonton, CA	11
Wuzhou, CN	6
Brussels, BE	5
Paris, FR	4
RBINS-Scientific Heritagelocation not on record	4
Geneva, CH	4
South Kensington, GB	3
Thiruvananthapuram Natural History Museumlocation not on record	3
National Museum of Natural Sciencelocation not on record	3
Washington, US	3
Copenhagen, DK	1
Provincia di Livornolocation not on record	1
Washington State University, Charles R. Conner Museumlocation not on record	1
KU Leuvenlocation not on record	1
Ugentlocation not on record	1
CASlocation not on record	1
Bonn, DE	1
CBDClocation not on record	1
MRAClocation not on record	1
Zografou, GR	1

26 institutions · 204 of 209 vouchered records shown · 5 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthus richardi

At a glance

Sources9 archives

Size & morphology13

Life cycle & reproduction7

Diet & foraging5

Habitat & environment4

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

At a glance

When this lineage existed

Record type84 900 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 26 geolocated

Record type84 900 records