Anthus bogotensis

P.L.Sclater, 1855 · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Passeriformes/Motacillidae/Anthus

At a glance

Occurrence records6 594

Data sources7

Biological traits22

DNA specimens8

eDNA detections0

Sources7 archives

Databases and archives Anthus bogotensis's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 594 records↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Occurrence & distributionGBIF6 594 records

DNA & barcodingBOLD8 specimens

01Narrative

The paramo pipit (Anthus bogotensis) is a species of bird in the family Motacillidae. It is found in Argentina, Bolivia, Colombia, Ecuador, Peru, and Venezuela. Its natural habitats are subtropical or tropical high-altitude grassland and pastureland. Illustration from Zoological Society of London, 1855

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBAVONETEltonTraits

Size & morphology12

Beak depth4.1 mm

Beak length (culmen)15.8 mm

Beak length (nares)8.8 mm

Beak width3.3 mm

Body mass24.88 g

Body mass (male)24.88 g

Hand-wing index19.2

Kipp's distance15.2 mm

Secondary length63.9 mm

Tail length57.8 mm

Tarsus length22.8 mm

Wing length79.2 mm

Diet & foraging6

Ground90 %

Invertebrate50 %

Seed50 %

Trophic levelomnivore

Trophic nicheInvertivore

Understory10 %

Habitat & environment4

HabitatGrassland

Migration1.0

Primary lifestyleTerrestrial

Range size336 034 km²

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthus bogotensis has left across the world's sequence archives.

At a glance

DNA specimens8

BINs2

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P694 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

7Tmostly conserved

19Cmostly conserved

82Tvariable

94Amostly conserved

133Tvariable

145Avariable

187Gvariable

283Cvariable

292Tvariable

299Amostly conserved

334Avariable

404Tvariable

430Cvariable

CCTATATCTGATCTTCGGCGCATGAGCTGGAATAGTAGGCACTGCCCTAAGCCTCCTCATCCGAGCAGAACTAGGCCAACCTGGAGCCCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.89%

Haplotypes5

BINs2

Most divergent pair1.7%

S.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthus hellmayrisame genus2.3%Anthus furcatussame genus6.6%Anthus correnderasame genus6.6%Anthus spragueiisame genus6.9%Anthus lutescenssame genus7.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type6 594 records

Wild obs. + sensor6 516

Museum / vouchered78

Origin

Native12

Range

Area of Occupancy AOO3 472 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 53≤1 km 12≤10 km 17>10 km 2

84 georeferenced · 6 432 without coordinates

Open the mapobservation + sensor6 516

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤1 km 16≤10 km 27>10 km 1

44 georeferenced · 34 without coordinates

Open the institutions mapphysical evidence78

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Seattle, US	25
Louisiana State University, Museum of Zoologylocation not on record	25
Moore Laboratory of Zoology, Occidental Collegelocation not on record	16
Wuzhou, CN	3
München, DE	2
Barcelona, ES	1
Universidad de Nariño (UdeNar)location not on record	1
Pontificia Universidad Javeriana (PUJ)location not on record	1
Geneva, CH	1
Museo de Historia Natural “Gustavo Orcés V"location not on record	1
Ann Arbor, US	1
South Kensington, GB	1

12 institutions · 78 of 78 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthus bogotensis

At a glance

Sources7 archives

Size & morphology12

Diet & foraging6

Habitat & environment4

At a glance

Record type6 594 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 12 geolocated

Record type6 594 records