Anthurium scandens
(Aubl.) Engl. · speciesAt a glance
Occurrence records4 336
Data sources10
Biological traits20
DNA specimens6
eDNA detections2
Sources10 archives
Databases and archives Anthurium scandens's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility4 336 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics6 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources20 traits
Occurrence & distributionGBIF4 336 records
Environmental DNA1 datasets · 1 countries2 detections
DNA & barcodingBOLD · NCBI6 specimens
Genome at a glanceCCDB2n = 48
01Narrative
Анту́риум ла́зающий — многолетнее травянистое вечнозелёное растение, вид рода Антуриум (Anthurium) семейства Ароидные, или Аронниковые (Araceae). Антуриум лазающий отличается более-менее лазающей жизненной формой, удлинёнными междоузлиями с обычно не опадающими катафиллами, обычно продолговато-овальными желёзисто-опушёнными листьями, дважды отогнутыми зелёными овальными покрывалами, цилиндрическими обычно бледно-зелёными початками и от бледно-лавандовых до почти белых ягодами.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTTRY
Life cycle & reproduction3
Life formepiphyte
Life spanperennial
Raunkiær life formchamaephyte
Diet & foraging1
Parasiteindependent
Habitat & environment9
Aquaticterrestrial
Climatewet tropical
Climberself-supporting
Elevation max2 800 m
Elevation min0 m
Epiphyteobligatory
Growth formherb
⚠ sources differ — GIFT: herb · TRY: Epiphyte
Habitat GIFTFloresta Estacional Semidecidual, Floresta Ombrófila (= Floresta Pluvial)
Woodinessnon-woody
Physiology & chemistry7
Leaf C:N ratio53.48 g/g
Leaf c449 mg/g
Leaf dry-matter content (LDMC)211 mg/g
Leaf n7.94 mg/g
Leaf p0.5 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)9.74 mm²/mg
05DNA & barcoding6 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthurium scandens has left across the world's sequence archives.
At a glance
DNA specimens6
Marker genes3
GenBank sequences10
eDNA detections2
Countries1
The DNA barcodea real sequence read deposited for this species
GAGACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGAT …
Anthurium scandens voucher Canek Ledesma 20270 (MEXU, US) ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK5★rbcL5★rbcLa
plant barcode
06Genome at a glanceCCDB
The complete instruction manual Anthurium scandens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 48 n = 24
Ploidypolyploid inferred
Chromosome records48–482n range48median48mode2records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 482×CCDB · ipcn-api-dl · CCDB · iapt
CCDB · ipcn-api-dl — Sheffer, R. & T. Croat. 1983. Chromosome numbers in the genus Anthurium (Araceae) II. Amer. J. Bot. 70: 858–871.
CCDB · iapt — IAPT/IOPB Chromosome Data 24
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type4 336 records
Wild obs. + sensor588
Museum / vouchered3 741
Cultivated / captive2
Other5
Origin
Native508
Range
Area of Occupancy AOO9 228 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy81% within 1 km
≤100 m 290≤1 km 71≤10 km 34>10 km 52
447 georeferenced · 141 without coordinates
Open the mapobservation + sensor588
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy78% within 1 km
≤100 m 548≤1 km 72≤10 km 136>10 km 39
795 georeferenced · 2 946 without coordinates
Open the institutions mapphysical evidence3 741
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 2 records without
Open the mapnot free-living2
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions88 of 225 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 646 |
| Durango, MX | 362 |
| Bronx, US | 183 |
| Mexico City, MX | 168 |
| National Biodiversity Institute, Costa Ricalocation not on record | 155 |
| Blumenau, BR | 112 |
| University of Stellenboschlocation not on record | 68 |
| Universidad Nacional de Colombia (UNAL)location not on record | 68 |
| Tuxtla Gutiérrez, MX | 62 |
| Chicago, US | 62 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 61 |
| JBRJlocation not on record | 60 |
| Universidad de Antioquia (UdeA)location not on record | 56 |
| South Kensington, GB | 48 |
| INMAlocation not on record | 44 |
| La Paz, BO | 44 |
| Laboratorio de Ictiologialocation not on record | 44 |
| Université de Bordeauxlocation not on record | 42 |
| Salvador, BR | 41 |
| Kew, GB | 33 |
| CEPLAClocation not on record | 33 |
| Universiti Sains Malaysialocation not on record | 30 |
| San Francisco, US | 30 |
| Santa Teresa, BR | 29 |
| UFMGlocation not on record | 26 |
| UFBAlocation not on record | 25 |
| Stockholm, SE | 25 |
| Feira de Santana, BR | 25 |
| San José, CR | 25 |
| Mexico City, MX | 25 |
| UNESP-RClocation not on record | 24 |
| Aarhus, DK | 23 |
| Austin, US | 22 |
| Cascavel, BR | 21 |
| Chongqing Museumlocation not on record | 21 |
| CASlocation not on record | 20 |
| UFESlocation not on record | 20 |
| Ann Arbor, US | 19 |
| Chaguaramas, TT | 18 |
| Fundación Jardín Botánico Joaquín Antonio Uribe de Medellín (JBM)location not on record | 18 |
| COLlocation not on record | 18 |
| QCNElocation not on record | 18 |
| Chapingo, MX | 18 |
| BGBMlocation not on record | 17 |
| Xiamen, CN | 17 |
| Ciudad de México, MX | 17 |
| Tampa, US | 16 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 16 |
| Federal University of Espírito Santolocation not on record | 16 |
| Madison, US | 15 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 15 |
| Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record | 15 |
| Tuxtla Gutiérrez, MX | 15 |
| UNICAMPlocation not on record | 13 |
| Universidade da Região de Joinville - Univillelocation not on record | 13 |
| Ivano-Frankivsk, UA | 13 |
| Universidad del Valle (UniValle)location not on record | 13 |
| HUT Culture Collectionlocation not on record | 13 |
| St. Paul, US | 12 |
| Universidad de Caldas (UCaldas)location not on record | 12 |
| Philadelphia, US | 12 |
| Austin, US | 12 |
| Cusco, PE | 12 |
| Cochabamba, BO | 12 |
| UFPRlocation not on record | 11 |
| UTFPR-CPlocation not on record | 10 |
| Berlin, DE | 10 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 10 |
| UNIVILLElocation not on record | 9 |
| UFRPElocation not on record | 9 |
| Mérida, MX | 9 |
| Provincia di Livornolocation not on record | 9 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 9 |
| Universidad de Nariño (UdeNar)location not on record | 9 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 9 |
| Göteborg, SE | 8 |
| UFOPlocation not on record | 8 |
| Loja, EC | 8 |
| CHAPAlocation not on record | 8 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 7 |
| IPA/SPlocation not on record | 7 |
| MEXUlocation not on record | 7 |
| Pontifícia Universidade Católica do Paranálocation not on record | 7 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 7 |
| Campo Mourão, BR | 7 |
| Tapachula, MX | 6 |
| UFPElocation not on record | 6 |
| Antiguo Cuscatlán, SV | 6 |
| Universidad de Guayaquillocation not on record | 6 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 6 |
| UNIVASFlocation not on record | 6 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 6 |
| Station d'Ecologie de Lamtolocation not on record | 5 |
| UNESClocation not on record | 5 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 5 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 5 |
| Universidade Federal do Vale do São Franciscolocation not on record | 5 |
| UTPLlocation not on record | 5 |
| PHlocation not on record | 5 |
| Quito, EC | 5 |
| Cambridge, US | 5 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 5 |
| Durham, US | 5 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 5 |
| Guatemala City, GT | 5 |
| FPMZBlocation not on record | 4 |
| Universidad Tecnológica del Chocó (UTCH)location not on record | 4 |
| Universidad de La Salle (La Salle)location not on record | 4 |
| Lima, PE | 4 |
| Fortaleza, BR | 4 |
| UFSClocation not on record | 4 |
| Universität Göttingenlocation not on record | 4 |
| OTSlocation not on record | 4 |
| Fredericksburg, US | 4 |
| Universidade Federal de Santa Catarinalocation not on record | 4 |
| UTFPR-DVlocation not on record | 3 |
| Santa Cruz de la Sierra, BO | 3 |
| Davis, US | 3 |
| HUAlocation not on record | 3 |
| Criciúma, BR | 3 |
| VENlocation not on record | 3 |
| BMlocation not on record | 3 |
| Area de Conservacion Guanacastelocation not on record | 3 |
| CEPEC, CEPLAC e Universidade Federal do Sul da Bahialocation not on record | 3 |
| UNESP-FCAlocation not on record | 3 |
| Fort Worth, US | 3 |
| MAlocation not on record | 3 |
| UNISANTAlocation not on record | 3 |
| Paris, FR | 3 |
| Altos de Pipe, VE | 3 |
| Iquitos, PE | 3 |
| Universidade de São Paulolocation not on record | 3 |
| UnBlocation not on record | 3 |
| Brasília, BR | 2 |
| San Francisco de Campeche, MX | 2 |
| Glocation not on record | 2 |
| Masindi, UG | 2 |
| PUC-RSlocation not on record | 2 |
| Miami, US | 2 |
| ESALQlocation not on record | 2 |
| USP-IBlocation not on record | 2 |
| Istituto Agrario Castelnuovolocation not on record | 2 |
| Cenargenlocation not on record | 2 |
| Wlocation not on record | 2 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 2 |
| Corporación Universitaria Santa Rosa de Cabal (UNISARC)location not on record | 2 |
| FUVATESlocation not on record | 2 |
| Universidad de la Amazonia (UniAmazonia)location not on record | 2 |
| Bogotá, D.C., CO | 2 |
| Universidad Industrial de Santander (UIS)location not on record | 2 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 2 |
| ASUlocation not on record | 2 |
| CUVClocation not on record | 2 |
| Bloomington, US | 2 |
| Universidad Católica de Oriente (UCO)location not on record | 2 |
| Minister of Sustainable Development, Climate Change & Solid Waste Managementlocation not on record | 2 |
| Montecillo, Texcoco, MX | 2 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 2 |
| FCMElocation not on record | 1 |
| Auckland, NZ | 1 |
| Museu Paraense Emílio Goeldilocation not on record | 1 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 1 |
| Monastir, TN | 1 |
| UFSCarlocation not on record | 1 |
| VALElocation not on record | 1 |
| PUC-RIOlocation not on record | 1 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 1 |
| San Diego, US | 1 |
| Zürich, CH | 1 |
| Universidade do Vale do Itajaílocation not on record | 1 |
| Cambridge, US | 1 |
| UNICAPlocation not on record | 1 |
| Universidade Paulistalocation not on record | 1 |
| EL PASO, US | 1 |
| Seropédica, BR | 1 |
| UFVJMlocation not on record | 1 |
| UTFPR-SLlocation not on record | 1 |
| Chicago, US | 1 |
| Ciudad de México, MX | 1 |
| HUENFlocation not on record | 1 |
| Cruz das Almas, BR | 1 |
| CPATSAlocation not on record | 1 |
| Museum of Zoologylocation not on record | 1 |
| Lake Charles, US | 1 |
| UNESP-IBILCElocation not on record | 1 |
| Universidade Tecnológica Federal do Paranálocation not on record | 1 |
| NO DISPONIBLElocation not on record | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| Río Palenque Science Centerlocation not on record | 1 |
| IAPlocation not on record | 1 |
| Universidad del Valle (UV)location not on record | 1 |
| Wayland Universitylocation not on record | 1 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| Universidad de Pamplona (UPamplona)location not on record | 1 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 1 |
| Universidade Federale do Rio Grande do Sullocation not on record | 1 |
| Maringá, BR | 1 |
| Puebla, MX | 1 |
| Mlocation not on record | 1 |
| HEMlocation not on record | 1 |
| Brasília, BR | 1 |
| Universidad Icesi (ICESI)location not on record | 1 |
| Departamento de Sistematica e Ecologialocation not on record | 1 |
| Alcaldía Municipal de Garzón en Huilalocation not on record | 1 |
| Anton de Kom University of Surinamelocation not on record | 1 |
| University of Bonnlocation not on record | 1 |
| Santiago de Cali, CO | 1 |
| Tuscaloosa, US | 1 |
| Jardim Botânico do Rio de Janeirolocation not on record | 1 |
| Dekalb, US | 1 |
| Cincinnati, US | 1 |
| Managua, NI | 1 |
| Santarém, BR | 1 |
| Autlán de Navarro, MX | 1 |
| Mexico City, MX | 1 |
| Calabar, NG | 1 |
| Plocation not on record | 1 |
| Wuzhou, CN | 1 |
| Provincial Museum of Albertalocation not on record | 1 |
| Universidade de São Paulolocation not on record | 1 |
| GB | 1 |
| UFRRJlocation not on record | 1 |
| HUAPlocation not on record | 1 |
| Christchurch, NZ | 1 |
225 institutions · 3 684 of 3 741 vouchered records shown · 57 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA2 detections
Where the DNA of Anthurium scandens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found2
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 2 detections have coordinates
Open the map1 country0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median23.4 °C 23.4–23.4
Seasonal swing summer↔winter2.30 °C
Max temp (day)25.6 °C
Min temp (night)21.2 °C
Precipitation288 mm/mo
Air humidity75.0 %
Moisture balance179 mm/mo
Vapour deficit717 Pa
Wind speed1.50 m/s
Cloud cover31.3 %
CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.