Anthurium ochranthum

K.Koch · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Alismatales/Araceae/Anthurium

At a glance

Occurrence records609

Data sources8

Biological traits12

DNA specimens6

eDNA detections4

Sources8 archives

Databases and archives Anthurium ochranthum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility609 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF609 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB5.3 Gbp

01Narrative

Anthurium ochranthum là một loài thực vật có hoa trong họ Ráy (Araceae). Loài này được K.Koch miêu tả khoa học đầu tiên năm 1853.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formsubshrub

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max2 000 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthurium ochranthum has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes3

GenBank sequences5

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLJQ590273.1 ↗550 bpCosta Rica · 2009

ACGT

AGTGTTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCA …

Anthurium ochranthum voucher BioBot05767 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL4★rbcLa

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Anthurium ochranthum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size5 256 750 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Anthurium ochranthum5.26 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 30 n = 15

Ploidydiploid inferred

Chromosome records30–602n range30median30mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 305×CCDB · ipcn-api-dl · CCDB · araceae

CCDB · ipcn-api-dl — Sheffer, R. & T. Croat. 1983. Chromosome numbers in the genus Anthurium (Araceae) II. Amer. J. Bot. 70: 858–871.

CCDB · ipcn-api-dl — SHEFFER, R. D. & H. Kamemoto. 1976. Chromosome numbers in the genus Anthurium. Amer. J. Bot. 63: 74 81.

CCDB · araceae — Sheffer & Croat, 1983

CCDB · araceae — Sheffer & Kamemoto, 1976

2n 602×CCDB · ipcn-api-dl · CCDB · araceae

CCDB · ipcn-api-dl — SHEFFER, R. D. & H. Kamemoto. 1976. Chromosome numbers in the genus Anthurium. Amer. J. Bot. 63: 74 81.

CCDB · araceae — Sheffer & Kamemoto, 1976

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type609 records

Wild obs. + sensor62

Museum / vouchered547

Range

Area of Occupancy AOO1 340 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 19≤1 km 18≤10 km 6>10 km 3

46 georeferenced · 16 without coordinates

Open the mapobservation + sensor62

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 2≤1 km 19≤10 km 25>10 km 16

62 georeferenced · 485 without coordinates

Open the institutions mapphysical evidence547

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	243
National Biodiversity Institute, Costa Ricalocation not on record	53
Museo Nacional de Costa Rica (MNCR)location not on record	43
Chicago, US	37
Universidad de Antioquia (UdeA)location not on record	37
Chongqing Museumlocation not on record	16
Bronx, US	13
San José, CR	12
BMlocation not on record	11
Universidad Nacional de Colombia (UNAL)location not on record	10
Durham, US	9
Provincial Museum of Albertalocation not on record	7
HUAlocation not on record	5
Area de Conservacion Guanacastelocation not on record	5
León, NI	4
South Kensington, GB	4
Provincia di Livornolocation not on record	3
COLlocation not on record	3
Universidad Nacional Autónoma de Honduraslocation not on record	2
Kew, GB	2
Fort Worth, US	2
University of Stellenboschlocation not on record	2
Fundación Jardín Botánico Joaquín Antonio Uribe de Medellínlocation not on record	1
Universidad Católica de Oriente (UCO)location not on record	1
Miami, US	1
SCZlocation not on record	1
Pontificia Universidad Javeriana (PUJ)location not on record	1
CASlocation not on record	1
Ann Arbor, US	1
Santiago de Cali, CO	1
Station d'Ecologie de Lamtolocation not on record	1
Madison, US	1
Tampa, US	1
Berlin, DE	1
Instituto Nacional de Biodiversidadlocation not on record	1
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	1
Wayland Universitylocation not on record	1

37 institutions · 538 of 547 vouchered records shown · 9 without an institution code

09Environmental DNA4 detections

Where the DNA of Anthurium ochranthum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.7 °C 23.4–23.7

Seasonal swing summer↔winter2.30 °C

Max temp (day)26.1 °C 25.7–26.1

Min temp (night)21.6 °C 21.3–21.6

Precipitation490 mm/mo 348–490

Air humidity75.7 % 75.2–75.7

Moisture balance362 mm/mo 234–362

Vapour deficit707 Pa 707–714

Wind speed1.10 m/s 1.10–1.40

Cloud cover39.1 % 33.6–39.1

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)