Anthurium acaule

(Jacq.) Schott · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Alismatales/Araceae/Anthurium

At a glance

Occurrence records33

Data sources11

Biological traits10

DNA specimens4

eDNA detections3

Sources11 archives

Databases and archives Anthurium acaule's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility33 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF33 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 30

01Narrative

Anthurium acaule (Jacq.) Schott, 1829 è una pianta della famiglia delle Aracee, originaria delle Piccole Antille.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formepiphyte

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition2 compounds

Compounds documented for Anthurium acaule across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Carbocyclic fatty acids2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
13-Phenyltridecanoic acid		present	LOTUS
15-Phenylpentadecanoic acid		present	LOTUS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthurium acaule has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences4

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKX783822.1 ↗552 bpEgypt · 2012

ACGT

AGTGTTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCA …

Anthurium acaule voucher Hosam00441 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★rbcLa

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Anthurium acaule carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 30 n = 15

Ploidydiploid inferred

Chromosome records30–302n range30median30mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 302×CCDB · book-indian_vol2 · CCDB · book-fedorov

CCDB · book-indian_vol2 — Gaiser, L.O. 1927

CCDB · book-fedorov — Gaiser 1927

n 154×CCDB · ipcn-api-dl · CCDB · araceae

CCDB · ipcn-api-dl — Bhattacharya, G. N. 1976. A cytological study on the tribe Anthurieae (Araceae). Bull. Bot. Soc. Bengal 30: 51–56.

CCDB · araceae — Sharma, 1970

CCDB · araceae — Bhattacharya, 1976

CCDB · araceae — Vij et al., 1982

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type33 records

Wild obs. + sensor7

Museum / vouchered26

Range

Area of Occupancy AOO64 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 2≤1 km 4>10 km 1

7 georeferenced

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 1≤10 km 1

2 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence26

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	6
Kew, GB	3
South Kensington, GB	2
Toronto, CA	2
Bronx, US	2
CASlocation not on record	2
Chicago, US	2
University of Stellenboschlocation not on record	1
Alexandria Universitylocation not on record	1
Universität Göttingenlocation not on record	1
St. Paul, US	1
MAlocation not on record	1
EL PASO, US	1

13 institutions · 25 of 26 vouchered records shown · 1 without an institution code

09Environmental DNA3 detections

Where the DNA of Anthurium acaule was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.2 °C 18.2–18.2

Seasonal swing summer↔winter11.7 °C

Max temp (day)21.4 °C

Min temp (night)15.0 °C

Precipitation3.10 mm/mo

Air humidity59.8 %

Moisture balance-143 mm/mo

Vapour deficit839 Pa

Wind speed4.70 m/s

Cloud cover31.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)