Anthriscus sylvestris
(L.) Hoffm. · speciesAt a glance
Occurrence records871 428
Data sources14
Biological traits52
DNA specimens54
eDNA detections2 727
Sources14 archives
Databases and archives Anthriscus sylvestris's data was compiled from.
WikipediaWikimedia Foundation15 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility871 428 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI2 727 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics54 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources52 traits
Chemical compositionLOTUS · NPASS125 compounds
Occurrence & distributionGBIF871 428 records
Environmental DNA3 datasets · 16 countries2 727 detections
DNA & barcodingBOLD · NCBI54 specimens
Genome at a glanceCCDB · GoaT1.9 Gbp
01Narrative
Anthriscus sylvestris, known as cow parsley, wild chervil, wild beaked parsley, Queen Anne's lace or keck, is a herbaceous biennial or short-lived perennial plant in the family Apiaceae (Umbelliferae),Webb, D.A., Parnell, J. and Doogue, D. 1996. An Irish Flora. Dundalgan Press Ltd, Dundalk. genus Anthriscus. It is also sometimes called mother-die (especially in the UK), a name that is also applied to the common hawthorn. It is native to Europe, western Asia and northwestern Africa. It is related to other diverse members of Apiaceae, such as parsley, carrot, hemlock and hogweed. It is often confused with Daucus carota, another member of the Apiaceae also known as "Queen Anne's lace" or "wild carrot".
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology16
Fruit length7.5 mm
Fruit length max10 mm
Fruit length min5 mm
Fruit width1.25 mm
Fruit width max1.5 mm
Fruit width min1 mm
Leaf mass891 mg
Leaf size5 487 mm²
⚠ sources differ — TRY: 5 487 mm² · LEDA: 22 864 mm² · GIFT: 22 864 mm²
Plant height0.7 m
⚠ sources differ — GIFT: 0.7 m · LEDA: 0.8 m · TRY: 0.517 m
Plant height generative0.731 m
Plant height max1.79 m
Plant height min0.5 m
Seed length1.68 mm
Seed mass3.86 mg
⚠ sources differ — TRY: 3.86 mg · LEDA: 4.2 mg · GIFT: 4.17 mg
Seed mass max8.82 mg
Seed mass min2.29 mg
Life cycle & reproduction13
Deciduousnessdeciduous
Dispersal typeanimal
Flowering endJul
Flowering startMay
Life formbiennial or perennial
Life spanperennial
Lifespan years3 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number928
Self fertilizationabsent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment11
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max4 500 m
Elevation mean4 500 m
Elevation min915 m
Epiphyteterrestrial
Growth formherb
Habitat GIFTcropfields,forest,meadows:wet,oldfields,parks
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry9
Leaf C:N ratio19.05 g/g
Leaf c436 mg/g
Leaf dry-matter content (LDMC)205 mg/g
Leaf n26.45 mg/g
Leaf p4.04 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)16.44 mm²/mg
⚠ sources differ — TRY: 16.44 mm²/mg · LEDA: 30 mm²/mg · GIFT: 31.19 mm²/mg
Wood density83.45 mg/cm³
Other traits1
Diaspore typegenerative dispersule
03Chemical composition125 compounds
Compounds documented for Anthriscus sylvestris across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Furostane steroids16
Arylnaphthalene and aryltetralin lignans11
Spirostane steroids10
Linear diarylheptanoids9
Ergostane steroids8
Documented compounds125 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (-)-Arctigenin | present | LOTUS | |
| (1S,3S,5S)-1-Isopropyl-4-methylenebicyclo[3.1.0]hexan-3-yl acetate | present | LOTUS | |
| (2R,3R,4S,5S,6R)-2-[(3R,5R)-1,7-bis(3,4-dihydroxyphenyl)-5-hydroxyheptan-3-yl]oxy-6-(hydroxymethyl)oxane-3,4,5-triol | present | NPASS | |
| (2R,3R,4S,5S,6R)-2-[(3R,5R)-1-(3,4-dihydroxyphenyl)-5-hydroxy-7-(4-hydroxyphenyl)heptan-3-yl]oxy-6-(hydroxymethyl)oxane-3,4,5-triol | present | NPASS | |
| (2R,3R,4S,5S,6R)-2-[(3R,5R)-5-hydroxy-1,7-bis(4-hydroxy-3-methoxyphenyl)heptan-3-yl]oxy-6-(hydroxymethyl)oxane-3,4,5-triol | present | NPASS | |
| (2R,3R,4S,5S,6R)-2-[(3R,5R)-5-hydroxy-1,7-bis(4-hydroxyphenyl)heptan-3-yl]oxy-6-(hydroxymethyl)oxane-3,4,5-triol | present | NPASS | |
| (2R,3R,4S,5S,6R)-2-[(3R,5R)-5-hydroxy-1-(4-hydroxy-3-methoxyphenyl)-7-(4-hydroxyphenyl)heptan-3-yl]oxy-6-(hydroxymethyl)oxane-3,4,5-triol | present | NPASS | |
| (2R,3R,4S,5S,6R)-2-[(3R,5R)-7-(3,4-dihydroxyphenyl)-5-hydroxy-1-(4-hydroxy-3-methoxyphenyl)heptan-3-yl]oxy-6-(hydroxymethyl)oxane-3,4,5-triol | present | NPASS | |
| (2R,3R,4S,5S,6R)-2-[(3R,5R)-7-(3,4-dihydroxyphenyl)-5-hydroxy-1-(4-hydroxyphenyl)heptan-3-yl]oxy-6-(hydroxymethyl)oxane-3,4,5-triol | present | NPASS | |
| (2R,3R,4S,5S,6R)-2-[[(2R,3S,4S,5R,6R)-5-[(2S,3R,4R,5S,6R)-3,4-dihydroxy-6-(hydroxymethyl)-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-6-[(2S,3R,6R)-6-[(3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-17-yl]-2,3-dimethylheptoxy]-3,4-dihydroxyoxan-2-yl]methoxy]-6-(hydroxymethyl)oxane-3,4,5-triol | present | NPASS |
05DNA & barcoding54 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthriscus sylvestris has left across the world's sequence archives.
At a glance
DNA specimens54
Marker genes6
GenBank sequences9
eDNA detections2 727
Countries16
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATTGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATC …
Anthriscus sylvestris voucher EDNA21-0060656 internal transcribed spacer region, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL1★rbcLa★ITS8★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Anthriscus sylvestris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 916 880 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Anthriscus sylvestris1.92 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 16 n = 8
Ploidy2× diploid · measured
Chromosome records16–182n range16median16mode53records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1650×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +15
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · iapt — IAPT/IOPB Chromosome Data 12
CCDB · brit-fl — Curran, P.L. Irish Naturalists' J. 16: 7-9 (1968)
CCDB · brit-fl — Hollingsworth, P.M., Gornall, R.J., Bailey, J.P. Watsonia 19: 134-137 (1992)
CCDB · brit-fl — Wentworth, J.E., Bailey, J.P., Gornall, R.J. Watsonia 18: 415-418 (1991)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3242
CCDB · fl-europaea — V. Sorsa, 1962
CCDB · poland — Pogan E., Czapik R. and Jankun A. et al. 1985. Further studies in chromosome numbers of Polish Angiosperms Part XVIII. Acta Biol. Cracov. Ser. Bot. 27, 57-74.
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1984. Khrom. Chisla Tsvet. Nauka, Novosibirsk.
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1982. The chromosome numbers of some species of the family Apiaceae. III. Bot. Zhurn. SSSR 67 (2): 206–210. (In Russian).
CCDB · ipcn-api-dl — Pashuk, K. T. 1987. Chromosome numbers in species of subalpine belt of Chernogora (Ukrainian Carpatians). Bot. Zhurn. 72: 1069–1074.
CCDB · ipcn-api-dl — Buttler, K. P. 1989. Chromosomenzahlen von Gefässpflanzen aus Hessen 4. Folge. Hess. Florist. Briefe 38: 11–14.
CCDB · ipcn-api-dl — Parfenov, V. I. & S. A. Dmitrieva. 1987. Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo Biosfernogo Zapovednika. II. Zapov. Belorussii Issl. 11: 62–69.
CCDB · ipcn-api-dl — Wentworth, J. E., J. P. Bailey & R. J. Gornall. 1991. Contributions to a cytological catalogue of the British and Irish flora, 1. Watsonia 18: 415–417.
CCDB · ipcn-api-dl — Hollingsworth, P. M., R. J. Gornall & J. P. Bailey. 1992. Contribution to a cytological catalogue of the British and Irish flora, 2. Watsonia 19: 134–137.
CCDB · ipcn-api-dl — Alexeeva, T. V., M. G. Vasil'eva, J. V. Daushkevich & M. G. Pimenov. 1994. IOPB chromosome data 8. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 23: 11–12.
CCDB · ipcn-api-dl — Van Loon, J. C. & B. Kieft. 1980. In Chromosome number reports LXVIII. Taxon 29: 538–542.
CCDB · ipcn-api-dl — Engelskjon, T. 1979. Chromosome numbers in vascular plants from Norway, including Svalbard. Opera Bot. 52: 1–38.
CCDB · ipcn-api-dl — HINDAKOVA, M. 1978. In Index of chromosome numbers of Slovakian flora. Part 6. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 26: 1–42.
CCDB · ipcn-api-dl — Pogan, E., R. CZAPIK & A. Jankun. 1985. Further studies in chromosome numbers of Polish angiosperms. Part XVIII. Acta Biol. Cracov., Ser. Bot. 27: 57–74.
CCDB · book-ipcn67-71 — GADELLA, Th. W. J., & E. KLIPHUIS. 1966.' Chromosome numbers of flowering plants in the Netherlands II. Proc. Roy. Neth. Acad. Sci. Ser. C. 69: 541-556.
CCDB · book-ipcn67-71 — CAUWET, A. - M. 1968. Contriburion a l'etude caryologique des Ombelliferes de la partie orientale des Pyrenees. Naturalia Monspel. Ser. Bot. 19: 5-27.
CCDB · book-ipcn67-71 — CURRAN, P.L. 1968. Chromosome numbers of sone Irish plants. Irish Naturalists' J. 16: 7-9.
CCDB · book-northern-plants — Turesson 1938.
CCDB · book-fedorov — Winge 1917h
CCDB · book-fedorov — Melderis 1~30
CCDB · book-fedorov — Schulz-Gaebel 1930
CCDB · book-fedorov — Wanscher 1931, 1932
CCDB · book-fedorov — Tischler 1934
CCDB · book-fedorov — Turesson 1938
CCDB · book-fedorov — Bocher, Larsen 1955
CCDB · book-fedorov — Love A., LOve D. 1956b
CCDB · book-fedorov — Hedberg O. 1957
CCDB · book-fedorov — Mulligan 1961a
CCDB · book-fedorov — Sorsa V. 1962, 1963b
CCDB · book-fedorov — Gadella, Kliphuis 1966
CCDB · book-atlas-flowering-plants — Wanscher 1931
CCDB · kew — Band SR. (pers. comm. 1984).
+9 more references
2n 183×CCDB · book-northern-plants · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants
CCDB · book-northern-plants — Tamamschjan 1933.
CCDB · book-fedorov — TaMallllliJIH 1933
CCDB · book-atlas-flowering-plants — Tamamschjan 1933
n 88×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · Cave1963 +1
CCDB · ipcn-api-dl — Wetschnig, W. & G. H. Leute. 1991. Chromosomenzahlen Kärntner Gefässflanzen (Teil 2, Doldenblütler---Apiaceae = Umbelliferae). Linzer Biol. Beitr. 23: 457–481.
CCDB · ipcn-api-dl — Alexeeva, T. V., M. G. Vasil'eva, J. V. Daushkevich & M. G. Pimenov. 1994. IOPB chromosome data 8. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 23: 11–12.
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1976. Chromosome numbers of some species of the family Apiaceae in South Siberia. Bot. Žhurn. (Moscow & Leningrad) 61(1): 93–99.
CCDB · book-ipcn67-71 — KORDYUM, E. L. 1967. Cyto-embryology of Umbellates. (In Russian). Naukova Dumka, Kiev, 1967, 128pp.
CCDB · Cave1963 — Sorsa 1962, 1963c
CCDB · CromoCat 2015 — Alexeeva, T. V., Vasileva, M. G., Daushkevich, J. V. & Pimenov, M. G. (1994). IOPB Chromosome Data 8 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 23 : 11-12.
CCDB · CromoCat 2015 — Wetschnig, W. & G. H. Leute. (1991). Chromosomenzahlen Kärntner Gefässflanzen (Teil 2, Doldenblütler---Apiaceae = Umbelliferae). Linzer Biol. Beitr. 23: 457-481.
CCDB · CromoCat 2015 — Sorsa, V. (1963b). Chromosomenzahlen Finnischer Kormophyten, II. Ann. Acad. Sci. Fenn., Sér. A 68: 1-14.
n 162×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · CromoCat 2015 — Arohonka, T. (1982). Kromosomilukumäärityksiä Nauvon Seilin saaren putkilokasveista. (Chromosome counts of vascular plants of the island Seiliin Nauvo, SW Finland) Turun Yliopiston Biologian Laitoksen Julkaisuja 3: 1-12.
n 242×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Chatterjee, A., S. Ghosh & S. C. Roy. 1989. A cytological survey of eastern Himalayan plants III. Cell Chromosome Res. 12: 22–29.
CCDB · CromoCat 2015 — Chatterjee, A., Ghosh, S. & Roy, S. C. (1989). A cytological survey of eastern Himalayan plants III. Cell Chromosome Res. 12: 22-29.
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Provontova, N. S & Kazanovsky, S .G & Rudyka, E.G & Barkalov, V.Y & Seledets, V.P & Nechaev, V.A (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1790-1794
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · family-scale
PloiDB · family-scale — chromEvol; reliability=0.128 ↗
07Deep time~2.35 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin2.35 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type871 428 records
Wild obs. + sensor857 093
Museum / vouchered12 189
Cultivated / captive692
Other1 454
Origin
Native44 192
Introduced24
Range
Area of Occupancy AOO740 392 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy55% within 1 km
≤100 m 196 666≤1 km 211 631≤10 km 328 177>10 km 4 564
741 038 georeferenced · 116 055 without coordinates
Open the mapobservation + sensor857 093
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy34% within 1 km
≤100 m 637≤1 km 2 055≤10 km 4 551>10 km 664
7 907 georeferenced · 4 282 without coordinates
Open the institutions mapphysical evidence12 189
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 23>10 km 12
35 georeferenced · 657 without coordinates
Open the mapnot free-living692
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions156 of 296 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 3 992 |
| BFLlocation not on record | 568 |
| Moscow State Universitylocation not on record | 563 |
| Helsinki, FI | 504 |
| Kuopio, FI | 320 |
| LDlocation not on record | 307 |
| Salzburg, AT | 240 |
| Olocation not on record | 199 |
| BRNUlocation not on record | 157 |
| Beijing, CN | 155 |
| Görlitz, DE | 135 |
| Oulu, FI | 130 |
| MeiseBGlocation not on record | 128 |
| Oskarshamn, SE | 121 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 114 |
| Jyväskylä, FI | 103 |
| SLU Artdatabankenlocation not on record | 101 |
| Uniwersytet Warszawskilocation not on record | 95 |
| Trondheim, NO | 95 |
| Université Lavallocation not on record | 87 |
| Turku, FI | 85 |
| Montréal, CA | 85 |
| Yangling, CN | 84 |
| Nanjing, CN | 79 |
| Chongqing Museumlocation not on record | 78 |
| TROMlocation not on record | 75 |
| MAlocation not on record | 74 |
| València, ES | 68 |
| Karlsruhe, DE | 66 |
| Tartu, EE | 65 |
| KMNlocation not on record | 65 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 58 |
| Bergen, NO | 58 |
| Chengdu, CN | 55 |
| Chengdu, CN | 55 |
| Provincia di Livornolocation not on record | 51 |
| TUR-Alocation not on record | 47 |
| Vitoria, ES | 47 |
| Barcelona, ES | 45 |
| Kunming, CN | 45 |
| South Kensington, GB | 43 |
| Tallinn, EE | 43 |
| National Institute of Biological Resourceslocation not on record | 42 |
| Berlin, DE | 40 |
| Nagano City, JP | 40 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 37 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 36 |
| Uniwersytet Śląski w Katowicachlocation not on record | 35 |
| BClocation not on record | 35 |
| Entomological Society of Latvialocation not on record | 34 |
| Odawara, JP | 34 |
| Burlington, US | 33 |
| BDBClocation not on record | 33 |
| Québec, CA | 31 |
| Christchurch, NZ | 29 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 28 |
| Guangzhou, CN | 25 |
| Tomioka, JP | 25 |
| Mlocation not on record | 25 |
| Tsukuba, JP | 24 |
| Bern, CH | 24 |
| WTUlocation not on record | 24 |
| Philadelphia, US | 23 |
| UGentlocation not on record | 22 |
| Xining, CN | 21 |
| KOMlocation not on record | 21 |
| Porvoo, FI | 21 |
| Wlocation not on record | 20 |
| GJOlocation not on record | 20 |
| Trois-Rivières, CA | 19 |
| CICYTEXlocation not on record | 18 |
| Kandalaksha State Nature Reservelocation not on record | 17 |
| KURAlocation not on record | 17 |
| Natural History Museum Rotterdamlocation not on record | 16 |
| NSMKlocation not on record | 16 |
| Kew, GB | 15 |
| Madison, US | 14 |
| Osaka, JP | 14 |
| GZUlocation not on record | 14 |
| KR | 13 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 13 |
| Lanzhou, CN | 13 |
| Appalachian State Universitylocation not on record | 12 |
| CJBGlocation not on record | 12 |
| Philadelphia, US | 12 |
| Corvallis, US | 11 |
| Uppsala, SE | 11 |
| Chiba, JP | 11 |
| University of New Hampshirelocation not on record | 11 |
| Wuzhou, CN | 11 |
| Museo Achille Folettolocation not on record | 11 |
| Madrid, ES | 11 |
| Otaru, JP | 11 |
| 11 | |
| Garðabær, IS | 10 |
| Kyoto Universitylocation not on record | 10 |
| Porrentruy, CH | 10 |
| Vancouver, CA | 10 |
| Edinburgh, GB | 10 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 10 |
| Frankfurt am Main | 9 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 9 |
| Ann Arbor, US | 9 |
| KIRMlocation not on record | 9 |
| Toronto, CA | 9 |
| Kushiro City Museumlocation not on record | 9 |
| Saint John, CA | 9 |
| Saint Louis, US | 8 |
| St. Paul, US | 8 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 8 |
| WNNUlocation not on record | 8 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 8 |
| Nishihara, JP | 8 |
| Zürich, CH | 8 |
| Palacký University in Olomouclocation not on record | 8 |
| Rovaniemi, FI | 7 |
| Pullman, US | 7 |
| Tilburg, NL | 7 |
| Ishikawa Museum of Natural Historylocation not on record | 7 |
| Pamplona, ES | 7 |
| DBF-NHMDlocation not on record | 7 |
| Zürich, CH | 7 |
| Philadelphia, US | 7 |
| College of the Atlantic, Museumlocation not on record | 7 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 7 |
| IDElocation not on record | 7 |
| ISAlocation not on record | 7 |
| AASlocation not on record | 7 |
| Acadia Universitylocation not on record | 6 |
| Salamanca, ES | 6 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 6 |
| Zhengzhou, CN | 6 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 6 |
| Guilin, CN | 6 |
| Peking Universitylocation not on record | 6 |
| Dover, US | 6 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 6 |
| Dresden, DE | 6 |
| College Park, US | 5 |
| Bourges, FR | 5 |
| Frauenfeld, CH | 5 |
| PRClocation not on record | 5 |
| Bronx, US | 5 |
| New Haven, US | 5 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 5 |
| Fulda, DE | 5 |
| Wuhan, CN | 5 |
| ESP109location not on record | 4 |
| Akita Prefectural Museumlocation not on record | 4 |
| Granada, ES | 4 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 4 |
| Tula State Universitylocation not on record | 4 |
| Auckland, NZ | 4 |
| Gijón, ES | 4 |
| Xian, CN | 4 |
| Tromso University Museumlocation not on record | 4 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 4 |
| Canberra, AU | 4 |
| University of Stellenboschlocation not on record | 4 |
| Uniwersytet Opolskilocation not on record | 3 |
| SWlocation not on record | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Jishou Universitylocation not on record | 3 |
| SZUlocation not on record | 3 |
| Cambridge, US | 3 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 3 |
| Mohonk Preservelocation not on record | 3 |
| Fort Worth, US | 3 |
| DASSHlocation not on record | 3 |
| Dekalb, US | 3 |
| Chicago, US | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| Hangzhou, CN | 3 |
| Stockholm, SE | 3 |
| Elocation not on record | 3 |
| Seoul, KR | 3 |
| Urumqi, CN | 3 |
| Wuhan, CN | 3 |
| University of Guelph, OAC Herbariumlocation not on record | 3 |
| Jaén, ES | 3 |
| Yunnan Universitylocation not on record | 2 |
| Victoria, CA | 2 |
| Beijing Normal Universitylocation not on record | 2 |
| KNAMlocation not on record | 2 |
| Xian, CN | 2 |
| Inner Mongolia Universitylocation not on record | 2 |
| WAGlocation not on record | 2 |
| BSBIlocation not on record | 2 |
| Columbia, US | 2 |
| Pamplona, ES | 2 |
| Central China Normal Universitylocation not on record | 2 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 2 |
| Flagstaff, US | 2 |
| Sion, CH | 2 |
| nbflocation not on record | 2 |
| ZRC-SAZUlocation not on record | 2 |
| Oswego, US | 2 |
| Denver, US | 2 |
| John May Museum of Natural Historylocation not on record | 2 |
| Badajoz, ES | 2 |
| Paris, FR | 2 |
| FLADlocation not on record | 2 |
| LfUlocation not on record | 2 |
| Whitehorse, CA | 2 |
| Forssa, FI | 2 |
| NoColllocation not on record | 2 |
| Museum of the Rockieslocation not on record | 2 |
| McWane Science Centerlocation not on record | 2 |
| Xiamen, CN | 2 |
| Moscow, US | 2 |
| University of Alberta Museumslocation not on record | 2 |
| IWEP FEB RASlocation not on record | 2 |
| Universidade Federal de Juiz de Foralocation not on record | 2 |
| Fukushima Universitylocation not on record | 2 |
| Miami, US | 1 |
| Whitewater, US | 1 |
| Göteborg, SE | 1 |
| Bloomington, US | 1 |
| DSMlocation not on record | 1 |
| Haramaya Universitylocation not on record | 1 |
| Awka, NG | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 1 |
| Adam Mickiewicz University in Poznańlocation not on record | 1 |
| Cambridge, US | 1 |
| Alicante, ES | 1 |
| Pittsburg, US | 1 |
| BMlocation not on record | 1 |
| Brisbane, AU | 1 |
| Portland, US | 1 |
| Clemson, US | 1 |
| Davenport, US | 1 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 1 |
| Institute of the biological problems of the North FEB RASlocation not on record | 1 |
| SNSNMClocation not on record | 1 |
| Brussel, BE | 1 |
| Millersville, US | 1 |
| Montréal, CA | 1 |
| Coimbra, PT | 1 |
| Zhejiang Universitylocation not on record | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Namur, BE | 1 |
| Beijing Natural History Museumlocation not on record | 1 |
| Fribourg, CH | 1 |
| DNSMlocation not on record | 1 |
| Monastir, TN | 1 |
| Tianjin Natural History Museumlocation not on record | 1 |
| Shanghai, CN | 1 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 1 |
| Sapporo, JP | 1 |
| Nanjing, CN | 1 |
| Guiyang, CN | 1 |
| Sagamihara, JP | 1 |
| Banyoles, ES | 1 |
| Xinxiang, CN | 1 |
| Shanghai, CN | 1 |
| Chapel Hill, US | 1 |
| Logan, US | 1 |
| IPE-CSIClocation not on record | 1 |
| Claremont, US | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| FFPRIlocation not on record | 1 |
| Portland, US | 1 |
| Glarus, CH | 1 |
| University of British Columbialocation not on record | 1 |
| Urumqi, CN | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Nijmegen, NL | 1 |
| Jiujiang Forestry Institutelocation not on record | 1 |
| Ypsilanti, US | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| National Museum Waleslocation not on record | 1 |
| TAFORI-LSRClocation not on record | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Pretoria, ZA | 1 |
| Universite de Montreal, L'Herbier Marie-Victorinlocation not on record | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| Fujian Institute of Subtropical Botanylocation not on record | 1 |
| Taipei, TW | 1 |
| Shenzhen, CN | 1 |
| Jiangxi College of Educationlocation not on record | 1 |
| Beijing, CN | 1 |
| JBCLMlocation not on record | 1 |
| Macomb, US | 1 |
| Riverside, US | 1 |
| EL PASO, US | 1 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 1 |
| DMZ botanic gardenlocation not on record | 1 |
| Bangkok, TH | 1 |
| Durham, US | 1 |
| GBR006location not on record | 1 |
| Mississippi State, US | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| Yugra State University Biological Collectionlocation not on record | 1 |
| Boise, US | 1 |
| National Botanic Garden of Waleslocation not on record | 1 |
296 institutions · 11 245 of 12 189 vouchered records shown · 641 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA2 727 detections
Where the DNA of Anthriscus sylvestris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found2 727
Studies independent surveys3
Countries16
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 2 727 detections have coordinates
Open the map16 countries0
Forest
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median12.4 °C 8.70–17.5
Seasonal swing summer↔winter22.2 °C
Max temp (day)14.7 °C 9.90–20.8
Min temp (night)9.20 °C 4.90–13.6
Precipitation82.3 mm/mo 61.1–141
Air humidity61.9 % 59.1–67.3
Moisture balance5.80 mm/mo -56.4–148
Vapour deficit560 Pa 367–784
Wind speed3.50 m/s 2.50–4.40
Cloud cover49.5 % 38.4–65.3
CHELSA 1981–2010, ~9 km grid, at location & month of 2 643 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.