Anthribus fasciatus

J.R.Forster, 1770 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Anthribidae/Anthribus

At a glance

Occurrence records305

Data sources7

Biological traits1

DNA specimens8

eDNA detections5

Sources7 archives

Databases and archives Anthribus fasciatus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility305 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF305 records

Environmental DNA1 datasets · 4 countries5 detections

DNA & barcodingBOLD8 specimens

01Narrative

Anthribus fasciatus is a species of fungus weevil in the family Anthribidae. It occurs widely in Europe and is present in the Near East and North Africa; it has been introduced to North America. It preys on Eulecanium tiliae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging1

Feeding guild (larval)predator

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthribus fasciatus has left across the world's sequence archives.

At a glance

DNA specimens8

BINs2

Marker genes1

eDNA detections5

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 83% of positions are identical in every specimen.

Where individuals differ — all 110 variable positions, in barcode order

16Cmostly conserved

19Tmostly conserved

46Cmostly conserved

49Gmostly conserved

50Cmostly conserved

55Amostly conserved

56Amostly conserved

59Tmostly conserved

61Amostly conserved

64Tmostly conserved

82Cmostly conserved

85Gmostly conserved

91Cmostly conserved

97Tmostly conserved

100Tmostly conserved

103Cmostly conserved

106Cmostly conserved

115Cmostly conserved

121Gmostly conserved

133Cmostly conserved

136Cmostly conserved

142Tmostly conserved

143Gmostly conserved

145Amostly conserved

163Tmostly conserved

172Amostly conserved

181Amostly conserved

184Cmostly conserved

190Tmostly conserved

197Cmostly conserved

202Tmostly conserved

208Cmostly conserved

214Amostly conserved

217Cmostly conserved

220Amostly conserved

223Amostly conserved

226Cmostly conserved

238Gmostly conserved

262Gmostly conserved

265Tmostly conserved

266Cmostly conserved

268Cmostly conserved

271Cmostly conserved

274Cmostly conserved

278Tmostly conserved

280Amostly conserved

284Cmostly conserved

290Amostly conserved

302Amostly conserved

322Tmostly conserved

325Amostly conserved

337Tmostly conserved

340Cmostly conserved

343Gmostly conserved

346Gmostly conserved

355Cmostly conserved

364Tmostly conserved

370Amostly conserved

373Amostly conserved

379Tmostly conserved

397Cmostly conserved

400Amostly conserved

401Cmostly conserved

403Tmostly conserved

409Amostly conserved

412Avariable

415Gmostly conserved

421Amostly conserved

428Cmostly conserved

433Amostly conserved

436Cmostly conserved

442Cmostly conserved

448Cmostly conserved

451Tmostly conserved

469Gmostly conserved

472Tmostly conserved

478Gmostly conserved

487Cmostly conserved

490Cmostly conserved

500Cvariable

517Tmostly conserved

526Tmostly conserved

529Tmostly conserved

532Tmostly conserved

539Cmostly conserved

541Tmostly conserved

542Cmostly conserved

544Avariable

547Cmostly conserved

550Gmostly conserved

556Tmostly conserved

562Amostly conserved

565Tmostly conserved

568Tmostly conserved

574Tmostly conserved

577Amostly conserved

586Amostly conserved

592Amostly conserved

601Cmostly conserved

604Tmostly conserved

610Cmostly conserved

616Cmostly conserved

619Tmostly conserved

622Amostly conserved

625Amostly conserved

628Amostly conserved

631Tmostly conserved

641Tmostly conserved

643Amostly conserved

652Cmostly conserved

AACTTTATATTTTATCTTTGGAGCTTGAGCAGGAATAATAGGAACCTCGCTAAGAATTTTAATTCGTATAGAATTAGGAAACCCGGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)8.4%

Haplotypes4

BINs2

Most divergent pair16.6%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Cryptophagus pilosussame order16.4%Mompha murtfeldtellasame order17.6%Glyphodes crithealissame order17.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type305 records

Wild obs. + sensor209

Museum / vouchered83

Other13

Range

Area of Occupancy AOO844 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 85≤1 km 38≤10 km 66

189 georeferenced · 20 without coordinates

Open the mapobservation + sensor209

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 5≤1 km 20≤10 km 43>10 km 2

70 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence83

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	21
MZLUlocation not on record	5
RBINS-Scientific Heritagelocation not on record	4
Uniwersytet Wrocławskilocation not on record	4
MNHWlocation not on record	4
Natural History Museum Rotterdamlocation not on record	3
Ugentlocation not on record	2
Tilburg, NL	2
Bavarian State Collection of Zoologylocation not on record	2
NCMGlocation not on record	2
Helsinki, FI	2
Vitoria, ES	1
Universita di Firenze, Museo di Storia Naturalelocation not on record	1
South Kensington, GB	1
Gothenburg, SE	1
CBDClocation not on record	1

16 institutions · 56 of 83 vouchered records shown · 27 without an institution code

09Environmental DNA5 detections

Where the DNA of Anthribus fasciatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.8 °C 10.4–17.5

Seasonal swing summer↔winter18.8 °C

Max temp (day)17.7 °C 14.6–22.2

Min temp (night)8.80 °C 5.40–11.1

Precipitation75.0 mm/mo 52.5–92.6

Air humidity58.1 % 56.6–62.3

Moisture balance-56.6 mm/mo -63.5–-19.9

Vapour deficit626 Pa 505–856

Wind speed2.70 m/s 2.20–4.30

Cloud cover39.3 % 35.3–42.7

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)