Anthreptes simplex

(S.Muller, 1843) · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Passeriformes/Nectariniidae/Anthreptes

At a glance

Occurrence records8 428

Data sources8

Biological traits27

DNA specimens13

eDNA detections7

Sources8 archives

Databases and archives Anthreptes simplex's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility8 428 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources27 traits

Occurrence & distributionGBIF8 428 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD13 specimens

01Narrative

The plain sunbird (Anthreptes simplex) is a species of bird in the family Nectariniidae. It is found in Brunei, Indonesia, Malaysia, Myanmar, Singapore, and Thailand. Its natural habitats are subtropical or tropical moist lowland forests and subtropical or tropical mangrove forests. Kota Kinabalu - Sabah, Borneo - Malaysia

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBEltonTraitsAVONET

Size & morphology13

Beak depth3.1 mm

Beak length (culmen)16 mm

Beak length (nares)11.8 mm

Beak width3.4 mm

Body mass9.43 g

⚠ sources differ — AmnioteDB: 9.43 g · AVONET: 8.93 g · EltonTraits: 8.93 g

Body mass (female)8.97 g

Body mass (male)9.45 g

Hand-wing index16.1

Kipp's distance9.7 mm

Secondary length50.2 mm

Tail length44.8 mm

Tarsus length14.9 mm

Wing length59.9 mm

Life cycle & reproduction1

Litter size2

Diet & foraging9

Canopy10 %

Fruit20 %

Invertebrate60 %

Midhigh60 %

Nectar10 %

Seed10 %

Trophic levelomnivore

Trophic nicheOmnivore

Understory30 %

Habitat & environment4

HabitatForest

Migration1.0

Primary lifestyleInsessorial

Range size1 062 053 km²

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthreptes simplex has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes2

eDNA detections7

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

16Cmostly conserved

17Gmostly conserved

22Amostly conserved

361Tmostly conserved

610Cmostly conserved

611Gmostly conserved

612Amostly conserved

613Cmostly conserved

616Cmostly conserved

625Gmostly conserved

643Cmostly conserved

CCTATACCTAATCTTCGGTGCATGAGCCGGAATGGTCGGCACCGCCCTGAGCCTCATCATCCGAGCAGAGCTAGGACAACCCGGAGCCCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.48%

Haplotypes5

BIN1

Most divergent pair1.4%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Cinnyris jugularissame family11.1%Cyanomitra verticalissame family11.8%Emberiza cioidessame order12.0%Phyllastrephus baumannisame order12.0%Chalcomitra senegalensissame family12.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PND2

animal barcodemitochondrial

08Occurrence & distribution

Record type8 428 records

Wild obs. + sensor8 273

Museum / vouchered155

Origin

Native49

Range

Area of Occupancy AOO3 856 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 93≤1 km 86≤10 km 30>10 km 25

234 georeferenced · 8 039 without coordinates

Open the mapobservation + sensor8 273

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤1 km 39≤10 km 21>10 km 6

66 georeferenced · 89 without coordinates

Open the institutions mapphysical evidence155

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
US	39
Louisiana State University, Museum of Zoologylocation not on record	24
Washington, US	19
Philadelphia, US	16
New Haven, US	13
	9
NHMOlocation not on record	8
Seattle, US	5
Cambridge, US	4
Wuzhou, CN	2
Paris, FR	1
Berkeley, US	1
Honolulu, US	1

13 institutions · 142 of 155 vouchered records shown · 13 without an institution code

09Environmental DNA7 detections

Where the DNA of Anthreptes simplex was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.8 °C 24.8–24.8

Seasonal swing summer↔winter1.10 °C

Max temp (day)28.2 °C 28.1–28.2

Min temp (night)21.8 °C

Precipitation324 mm/mo 324–401

Air humidity70.6 % 70.6–71.3

Moisture balance185 mm/mo 185–269

Vapour deficit917 Pa 893–917

Wind speed0.7 m/s

Cloud cover61.9 % 60.2–61.9

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthreptes simplex

At a glance

Sources8 archives

Size & morphology13

Life cycle & reproduction1

Diet & foraging9

Habitat & environment4

At a glance

Record type8 428 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type8 428 records