Anthrenus castaneae

Melsheimer, 1844 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Dermestidae/Anthrenus

At a glance

Occurrence records164

Data sources7

Biological traits0

DNA specimens20

eDNA detections16

Sources7 archives

Databases and archives Anthrenus castaneae's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility164 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF164 records

Environmental DNA1 datasets · 1 countries16 detections

DNA & barcodingBOLD20 specimens

01Narrative

Anthrenus castaneae is a species of carpet beetle in the family Dermestidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthrenus castaneae has left across the world's sequence archives.

At a glance

DNA specimens20

BINs1

Marker genes1

eDNA detections16

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P640 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.47%

Haplotypes2

BIN1

Most divergent pair0.78%

Where individuals differ — all 13 variable positions, in barcode order

34Tmostly conserved

37Gvariable

50Cmostly conserved

121Amostly conserved

136Cmostly conserved

263Cmostly conserved

268Tmostly conserved

337Gmostly conserved

343Cmostly conserved

448Cmostly conserved

472Amostly conserved

538Gmostly conserved

568Tvariable

AACTCTTTATTTCATTTTCGGAGCATGAGCAGGTATGACAGGCACTTCCCTAAGAATTCTAATTCGAACAGAATTAGGAAACCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthrenus museorumsame genus15.2%Anthrenus fuscussame genus15.9%Globicornis nigripessame family16.5%Prosternon medianumsame order17.2%Dermestes tessellatocollissame family17.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type164 records

Wild obs. + sensor38

Museum / vouchered126

Range

Area of Occupancy AOO308 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 20≤1 km 5≤10 km 2>10 km 8

35 georeferenced · 3 without coordinates

Open the mapobservation + sensor38

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 38>10 km 8

46 georeferenced · 80 without coordinates

Open the institutions mapphysical evidence126

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	39
University Park, US	37
North Carolina State University Insect Museumlocation not on record	12
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	9
East Lansing, US	8
University of Guelphlocation not on record	7
Saint John, CA	5
Wuzhou, CN	3
Washington, US	2
Royal British Columbia Museumlocation not on record	2
CUlocation not on record	1
Universidad Católica de Manizaleslocation not on record	1

12 institutions · 126 of 126 vouchered records shown

09Environmental DNA16 detections

Where the DNA of Anthrenus castaneae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map1 country0

Forest1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.4 °C 16.6–20.6

Seasonal swing summer↔winter28.8 °C

Max temp (day)23.1 °C 20.6–25.1

Min temp (night)15.0 °C 13.1–18.2

Precipitation90.3 mm/mo 77.1–101

Air humidity59.0 % 58.3–60.5

Moisture balance-49.6 mm/mo -83.3–-27.2

Vapour deficit865 Pa 727–994

Wind speed2.70 m/s 2.30–4.40

Cloud cover42.1 % 39.3–48.2

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)