Anthrax irroratus

Say, 1823 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Bombyliidae/Anthrax

At a glance

Occurrence records739

Data sources6

Biological traits0

DNA specimens15

eDNA detections13

Sources6 archives

Databases and archives Anthrax irroratus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility739 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF739 records

Environmental DNA1 datasets · 2 countries13 detections

DNA & barcodingBOLD15 specimens

01Narrative

Anthrax irroratus is een vliegensoort uit de familie van de wolzwevers (Bombyliidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1823 door Say.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthrax irroratus has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes1

eDNA detections13

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 79 variable positions, in barcode order

1Amostly conserved

2Amostly conserved

3Cmostly conserved

4Tmostly conserved

7Amostly conserved

8Tmostly conserved

9Amostly conserved

10Tmostly conserved

11Tmostly conserved

12Tmostly conserved

13Cmostly conserved

14Amostly conserved

15Tmostly conserved

16Cmostly conserved

17Tmostly conserved

18Tmostly conserved

22Amostly conserved

23Gmostly conserved

24Cmostly conserved

26Tmostly conserved

27Gmostly conserved

30Cmostly conserved

31Tmostly conserved

32Gmostly conserved

33Gmostly conserved

34Amostly conserved

35Amostly conserved

36Tmostly conserved

37Amostly conserved

38Gmostly conserved

40Amostly conserved

41Gmostly conserved

45Cmostly conserved

47Tmostly conserved

48Cmostly conserved

49Cmostly conserved

50Cmostly conserved

53Amostly conserved

56Amostly conserved

57Tmostly conserved

58Cmostly conserved

59Cmostly conserved

60Tmostly conserved

62Gmostly conserved

65Cmostly conserved

67Amostly conserved

68Gmostly conserved

69Cmostly conserved

70Amostly conserved

71Gmostly conserved

72Amostly conserved

74Tmostly conserved

75Tmostly conserved

76Amostly conserved

77Gmostly conserved

78Gmostly conserved

80Cmostly conserved

81Amostly conserved

83Cmostly conserved

84Cmostly conserved

85Amostly conserved

88Cmostly conserved

184Tmostly conserved

271Cvariable

274Cvariable

283Tmostly conserved

312Gvariable

316Amostly conserved

322Amostly conserved

368Gmostly conserved

373Amostly conserved

400Cmostly conserved

409Cmostly conserved

433Avariable

478Gvariable

481Cvariable

544Cmostly conserved

577Amostly conserved

646Cmostly conserved

AACTTTATATTTCATCTTTGGAGCATGAGCTGGAATAGTAGGAACCTCCCTAAGAATCCTAGTACGAGCAGAATTAGGTCACCCAGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.4%

Haplotypes6

BIN1

Most divergent pair1.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthrax incomptussame genus15.5%Phyllomydas parvulussame order15.7%Liancalus virenssame order16.1%Phalacrotophora longifronssame order16.6%Medetera bistriatasame order17.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type739 records

Wild obs. + sensor429

Museum / vouchered310

Origin

Native1

Range

Area of Occupancy AOO1 980 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 237≤1 km 64≤10 km 16>10 km 27

344 georeferenced · 85 without coordinates

Open the mapobservation + sensor429

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy70% within 1 km

≤100 m 72≤1 km 29≤10 km 39>10 km 5

145 georeferenced · 165 without coordinates

Open the institutions mapphysical evidence310

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Vancouver, CA	94
Ciudad de México, MX	67
Essig Museum of Entomologylocation not on record	49
Mexico City, MX	39
Santa Cruz, US	19
San Francisco, US	15
University of Guelphlocation not on record	9
Natural History Museum of Utahlocation not on record	6
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Wuzhou, CN	1
San Luis Potosí, MX	1
CUlocation not on record	1
University Park, US	1
US	1
Los Angeles, US	1
Blacksburg, US	1
Toronto, CA	1
Cleveland Museum of Natural History, OH (CLEV)location not on record	1
Colorado State Universitylocation not on record	1
Lake Placid, US	1

20 institutions · 310 of 310 vouchered records shown

09Environmental DNA13 detections

Where the DNA of Anthrax irroratus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map2 countries0

4. Native Grassland | 4.4. Temperate GrasslandTemperate mixed forestMixed habitatGrasslandForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.7 °C 15.3–21.2

Seasonal swing summer↔winter26.1 °C

Max temp (day)24.5 °C 20.6–28.5

Min temp (night)13.4 °C 11.8–17.2

Precipitation75.2 mm/mo 26.0–84.6

Air humidity58.6 % 49.3–60.3

Moisture balance-69.4 mm/mo -149–-9.30

Vapour deficit932 Pa 702–1,272

Wind speed3.40 m/s 2.20–3.70

Cloud cover40.0 % 30.1–47.6

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)