Anthracothecium prasinum

(Eschw.) R.C.Harris · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Pyrenulales/Pyrenulaceae/Anthracothecium

At a glance

Occurrence records336

Data sources6

Biological traits1

DNA specimens1

eDNA detections1

Sources6 archives

Databases and archives Anthracothecium prasinum's data was compiled from.

GBIFGlobal Biodiversity Information Facility336 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF336 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

02Traits & measurements

SourcesTRY

Habitat & environment1

Growth formlichen

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthracothecium prasinum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences9

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKT820084.1 ↗604 bp

ACGT

AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGAGTGAGGGCCTCTGAGACCCGACCTCCAACCCTGTGTTTAA …

Anthracothecium prasinum voucher CG1734 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS9

fungal barcode

08Occurrence & distribution

Record type336 records

Wild obs. + sensor214

Museum / vouchered120

Other2

Range

Area of Occupancy AOO380 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 214 records without

Open the mapobservation + sensor214

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 7≤1 km 18≤10 km 3>10 km 2

30 georeferenced · 90 without coordinates

Open the institutions mapphysical evidence120

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Berlin, DE	27
Chicago, US	15
Canberra, AU	14
UFMSlocation not on record	11
MeiseBGlocation not on record	10
South Kensington, GB	6
Mexico City, MX	6
FLASlocation not on record	4
Masindi, UG	4
Durham, US	3
Brisbane, AU	3
University of Stellenboschlocation not on record	2
National Biodiversity Institute, Costa Ricalocation not on record	2
Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record	2
M-Lichenslocation not on record	2
IAPlocation not on record	2
DOI/NPS, Colonial National Historical Parklocation not on record	1
US	1
ASUlocation not on record	1
Coimbra, PT	1
Boise, US	1
Bronx, US	1
IPA/SPlocation not on record	1

23 institutions · 120 of 120 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Anthracothecium prasinum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)