Anthoxanthum odoratum
speciesAt a glance
Occurrence records990 304
Data sources15
Biological traits72
DNA specimens86
eDNA detections44
Sources15 archives
Databases and archives Anthoxanthum odoratum's data was compiled from.
WikipediaWikimedia Foundation14 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility990 304 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI44 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics86 specimens↗
NCBIUS National Library of Medicinesequences↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources72 traits
Chemical compositionNPASS2 compounds
Occurrence & distributionGBIF990 304 records
Environmental DNA1 datasets · 10 countries44 detections
DNA & barcodingBOLD · NCBI86 specimens
Genome at a glanceCCDB · GoaT6.4 Gbp
01Narrative
Anthoxanthum odoratum, known as sweet vernal grass, is a short-lived perennial grass that is native to acidic grassland in Eurasia and northern Africa. It is grown as a lawn grass and a house plant, due to its sweet scent, and can also be found on unimproved pastures and meadows. The specific epithet odoratum is Latin for 'odorous'.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology26
Inflorescence length max6 cm
Inflorescence length min2 cm
Leaf length200 mm
Leaf length max110 mm
Leaf length min1 mm
Leaf mass2.31 mg
Leaf size734 mm²
Leaf width3.5 mm
⚠ sources differ — AusTraits: 3.5 mm · GIFT: 5 mm
Leaf width max6 mm
Leaf width min2 mm
Plant height0.233 m
⚠ sources differ — GIFT: 0.233 m · AusTraits: 0.8 m · LEDA: 0.165 m · TRY: 0.229 m
Plant height generative0.4 m
Plant height max1 m
Plant height min0.1 m
Seed length5.9 mm
⚠ sources differ — TRY: 5.9 mm · GIFT: 1.6 mm
Seed length max1.6 mm
Seed length min1.6 mm
Seed mass0.499 mg
⚠ sources differ — TRY: 0.499 mg · AusTraits: 0.53 mg · LEDA: 0.627 mg · GIFT: 0.556 mg
Seed mass max0.73 mg
Seed mass min0.29 mg
Seed volume0.77 mm³
Seed volume max0.79 mm³
Seed volume min0.75 mm³
Seed width0.75 mm
Seed width max0.75 mm
Seed width min0.75 mm
Life cycle & reproduction18
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dispersal typehuman
⚠ sources differ — LEDA: agochor · GIFT: anemochorous
Flower length max2.5 mm
Flower length min2 mm
Flowering endJun
Flowering startApr
Flowering timeyynnnnnnyyyy
Life formperennial
Life spanperennial
Lifespan years3 years
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Resprouting capacityresprouts
Seed number24.8
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max4 500 m
Elevation mean2 600 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecaryopsis
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: graminoid
Habitat GIFTÁrea Antrópica
Mycorrhiza typeAMNM
Woodinessnon-woody
Physiology & chemistry10
Leaf C:N ratio18.66 g/g
Leaf c449 mg/g
Leaf dry-matter content (LDMC)281 mg/g
⚠ sources differ — TRY: 281 mg/g · LEDA: 259 mg/g
Leaf n22.61 mg/g
Leaf p1.54 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)25.09 mm²/mg
⚠ sources differ — TRY: 25.09 mm²/mg · LEDA: 30.03 mm²/mg · GIFT: 29.77 mm²/mg
Wood density77.86 mg/cm³
Other traits3
Diaspore typeone-seeded generative dispersule
Inflorescencepanicle
Seeds per fruit101-1000
03Chemical composition2 compounds
Compounds documented for Anthoxanthum odoratum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile1 class
Flavonols1
Documented compounds2 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| D-Tartaric acid | present | NPASS | |
| Quercitrin | present | NPASS |
05DNA & barcoding86 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthoxanthum odoratum has left across the world's sequence archives.
At a glance
DNA specimens86
Marker genes11
GenBank sequences10
eDNA detections44
Countries11
The DNA barcodea real sequence read deposited for this species
AAAACACGCTCCAAAAACCCTCATTTGGGAATGGGATGCGGCATTTGGCCCCCCGTCACGCAAGGGTGGTGGGCCGAAGATATGGCTGCC …
Anthoxanthum odoratum clone POTU_67 internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL3★rbcLa★ITS5★ITS1★ITS2atpF-atpHpsbK-psbIrpoBrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Anthoxanthum odoratum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size6 405 900 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Anthoxanthum odoratum6.41 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 10 n = 5
Ploidy4× tetraploid · measured
Chromosome records10–282n range15median10mode166records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1083×CCDB · ita-fl · CCDB · slov-fl · CCDB · iapt +15
CCDB · ita-fl — GARBARI F., MICELI P., MONTI G. - 1980. Numeri cromosomici per la flora italiana:676-682.. Inform. Bot. Ital. , 12(2): 107-111.
CCDB · ita-fl — BOECHER T.W. - 1961. Experimental and cytological studies on plant species. VI. Dactylis glomerata and Anthoxanthum odoratum.. Bot. Tidsskr. , 56(4): 314-335.
CCDB · slov-fl — Váchová M., 1987: Karyological study of the Slovak flora XXI. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 34: 27-32.
CCDB · slov-fl — Májovský J. et al., 1974a: Index of chromosome numbers of Slovakian flora (Part 3). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 22: 1-20.
CCDB · slov-fl — Rozmus M., 1964: Badania cytogenetyczne nad biotypami Anthoxanthum alpinum L. et L. z dodatkowymi chromosomami. - Cytogenetical studies in biotypes of Anthoxanthum alpinum with accessory chromosomes. - Acta Biol. Cracov. Ser. Botanica 6/2 [1963]: 115-143.
CCDB · iapt — IAPT/IOPB Chromosome Data 13
CCDB · fl-europaea — I. Hedberg, 1970
CCDB · poland — Skali?ska M., Banach-Pogan E., Wcis?o H. et al. 1957. Further studies in chromosome numbers of Polish Angiosperms. Acta Soc. Bot. Pol. 26, 215-246.
CCDB · poland — Rozmus M. 1958. Cytological investigations on Anthoxanthum alpinum L. et L. a new species of the flora of Poland. Acta Biol. Cracov. Ser. Bot. 1, 171-184.
CCDB · mediterranean
CCDB · book-ipcn65 — Laane 1965
CCDB · ipcn-api-dl — Engelskjon, T. 1979. Chromosome numbers in vascular plants from Norway, including Svalbard. Opera Bot. 52: 1–38.
CCDB · ipcn-api-dl — Magulaev, A. V. 1984. Cytotaxonomic study in some flowering plants of the North Caucasus. Bot. Zhurn. SSSR 69(4): 511–517.
CCDB · ipcn-api-dl — Pashuk, K. T. 1987. Chromosome numbers in species of subalpine belt of Chernogora (Ukrainian Carpatians). Bot. Zhurn. 72: 1069–1074.
CCDB · ipcn-api-dl — Felber, F. 1991. Mediterranean chromosome number reports 1 (26--27). Fl. Medit. 1: 236–237.
CCDB · ipcn-api-dl — Krahulcová, A. 1990. Selected chromosome counts of the Czechoslovak flora II. Folia Geobot. Phytotax. 25: 381–388.
CCDB · ipcn-api-dl — Felber, F. 1993. Prĕsence de trois taxons pĕrennes d'Anthoxanthum L. en Corse. Candollea 48(2): 582–591.
CCDB · ipcn-api-dl — Straka, G. 2000. In C. Dobea & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna.
CCDB · ipcn-api-dl — Váchová, M. 1987. Karyological study of the Slovak flora XXI. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 34: 27–32.
CCDB · ipcn-api-dl — Garbari, F., P. Miceli & G. Monti. 1980. Numeri cromosomici per la Flora Italiana: 676-682. Inform. Bot. Ital. 12: 107–111.
CCDB · ipcn-api-dl — Gregor, T. & R. Hand. 2009. Chromosomenzahlen von Farn- und Samenpflanzen aus Deutschland 4. Kochia 4: 37–46.
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Baltisberger, M. 1991. Cytological investigations of some Greek plants. Fl. Medit. 1: 157–173.
CCDB · ipcn-api-dl — Teppner, H. 1998. Anthoxanthum maderense spec. nova und A. odoratum (Poaceae--Aveneae) von Madeira und deren Chromosomen-Morphologie. Phyton (Horn) 38(2): 307–321.
CCDB · book-ipcn66 — Polatschek 1966
CCDB · book-ipcn66 — Aaberge in Knaben 1966a
CCDB · book-ipcn66 — Tateoka 1966
CCDB · book-ipcn67-71 — HEDBERG, I. 1967. Cytotaxonornic studies on Anthoxanthurn odoraturn L. s. lat. II. Investigations of some Swedish and a few Swiss population samples. syrn. Bot. Upsal. 18: 5: 1-88.
CCDB · book-ipcn67-71 — LOEVE A., & D. LOEVE. 1968. The diploid perennial Anthoxanthum. Science in Iceland 1968: 26-30.
CCDB · book-ipcn67-71 — POGHOSIAN, A.J., S.G. NARINIAN, & V.E. VOSKANIAN. 1971. Data on the caryogeographical study of flora of the Aragatz massif. Biol. Zurn. Armenii 24: 11: 37-43.
CCDB · book-ipcn73-74 — DERSCH, G. 1974. Ueber einige Chromosomenzahlungen an mitteleuropaischen Blutenpflanzen. II. Philippia 2: 75-82.
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian flora. (Part 3). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 22: 1-20.
CCDB · book-indian_vol2 — Contandriopoulos, J. 1957a ; Hedberg, I. 1964 ; Poghosian, A.J. et al. 1971 ; Kozuharov, S.I. & Petrova, A.V. 1973 ; Pouca-Cornanesu, M. & Tonciu, M. 1978
CCDB · book-fedorov — Bocher, Larsen 1950
CCDB · book-fedorov — Knaben 1950
CCDB · book-fedorov — Tutin 1950a
CCDB · book-fedorov — CoKoxoucKaJI 1955
CCDB · book-fedorov — Uive A., LOve D. 1956b
CCDB · book-fedorov — Jorgensen et al. 1958
CCDB · book-fedorov — CoKOJIOBCKaJI, CTpenKOBa 1960
+18 more references
2n 2082×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +21
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — TEPPNER H. - 0. ,. ,0, , : .
CCDB · slov-fl — Májovský J. et al., 1970b: Index of chromosome numbers of Slovakian flora Part 2. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 18: 45-60.
CCDB · slov-fl — Hindáková M. & Záborský J., 1977: [Report], pp. 262. - In: Löve Á. (ed.), IOPB Chromosome number reports LVI, Taxon 26 /2-3.
CCDB · iapt — IAPT/IOPB Chromosome Data 8
CCDB · brit-fl — Jones, K. Chromosoma 15: 248-274 (1964)
CCDB · brit-fl — Richards, A.J. (23.i.1970)
CCDB · brit-fl — Tutin, T.G. Watsonia 1: 224-227 (1950)
CCDB · brit-fl — Hedberg, O. Svensk Bot. Tidskr. 52: 37-46 (1958)
CCDB · brit-fl — McAllister, H. (1993)
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. I. Gramineae, supl. 1 Queirs, M.Bol. Soc. Brot. ser. 247: 77-103(1973).
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. I. Gramineae, supl. 2 Queirs, M.Bol. Soc. Brot. ser. 248: 81-98(1974).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. I. Gramineae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 243: 20-140(1969).
CCDB · iber-fl — Nmeros cromosmicos de algunas plantas espaolas. I. Valds, B.Lagascalia3(2): 211-217(1973).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4539
CCDB · fl-europaea — Majovsky et al.,
CCDB · poland — Skali?ska M., Banach-Pogan E., Wcis?o H. et al. 1957. Further studies in chromosome numbers of Polish Angiosperms. Acta Soc. Bot. Pol. 26, 215-246.
CCDB · poland — Rozmus M. 1958. Cytological investigations on Anthoxanthum alpinum L. et L. a new species of the flora of Poland. Acta Biol. Cracov. Ser. Bot. 1, 171-184.
CCDB · book-ipcn65 — Gray 1965; Laane 1965
CCDB · ipcn-api-dl — Pohl, R. W. & G. Davidse. 1971. Chromosome numbers of Costa Rican grasses. Brittonia 23(3): 293–324.
CCDB · ipcn-api-dl — Kirschner, J., J. Stepanek & J. Stepankova. 1982. In IOPB chromosome number reports LXXVI. Taxon 31: 574–575.
CCDB · ipcn-api-dl — Mehra, P. N. 1982. Cytology of East Indian grasses. ý.
CCDB · ipcn-api-dl — Davlianidze, M. & M. Mosulischvili. 1984. Numerus chromosomatum de plantis nonnullis Gramineae florae Georgiae. Not. Syst. Georg. Inst. Bot. Thbilissi. 40: 68–72.
CCDB · ipcn-api-dl — Guzik, M. B. 1984. Khromosomnye chisla nekotorykh dikorastushchikh zlakov Predural'ja. Ekologija Opylenija Rastenij. Mezhvuzovskij Sbornik Nauchnykh Trudov. Perm. 82–86.
CCDB · ipcn-api-dl — Felber, F. 1986. Distribution des cytodèmes d'Anthoxanthum odoratum L. s. lat. en Suisse. Les relations Alpes--Jura. Bot. Helv. 96: 145–158.
CCDB · ipcn-api-dl — Galland, N. 1988. Recherche sur l'origine de la flore orophile du Maroc étude caryologique et cytogéographique. Trav. Inst. Sci. Univ. Mohammed V, Sér. Bot. 35: 1–168.
CCDB · ipcn-api-dl — Parfenov, V. I. & S. A. Dmitrieva. 1987. Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo Biosfernogo Zapovednika. II. Zapov. Belorussii Issl. 11: 62–69.
CCDB · ipcn-api-dl — Teppner, H. 1998. Anthoxanthum maderense spec. nova und A. odoratum (Poaceae--Aveneae) von Madeira und deren Chromosomen-Morphologie. Phyton (Horn) 38(2): 307–321.
CCDB · ipcn-api-dl — Engelskjon, T. 1979. Chromosome numbers in vascular plants from Norway, including Svalbard. Opera Bot. 52: 1–38.
CCDB · ipcn-api-dl — Gvinianidze, Z. & A. Avazneli. 1980. Investigatio caryologica complexus florisciti. Not. Syst. Georg. Inst. Bot. Akad. Nauk. Gruzinsk. (Tbilisi). 36: 71–74.
CCDB · ipcn-api-dl — Parkash, O. 1979. Cytological investigations in some grasses of northeastern India (Festucoids, Ischaemum Linn., Eulalia Kunth and Saccharum spontaneum Linn.). Ph.D. Thesis, Chandigarh. 1979.
CCDB · book-ipcn66 — Aaberge in Knaben 1966a
CCDB · book-ipcn72 — LOVKA, M., F. SUSNIK, A. LOEVE, & D. LOEVE. 1972. In IOPB chromosome number reports XXXVI. Taxon 21: 333-346.
CCDB · book-ipcn67-71 — LOEVE A., & D. LOEVE. 1968. The diploid perennial Anthoxanthum. Science in Iceland 1968: 26-30.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · book-ipcn67-71 — FERNANDES, A . & M. QUEIROS. 1969. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. I. Gramineae. Bol. Soc. Brat. 43(ser.2l: 3-140.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora. (Part 2). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 18: 45-60.
CCDB · book-ipcn67-71 — POHL, R.W., & G. DAVIDSE. 1971. Chromosome numbers of Costa Rican grasses. Brittonia 23: 293-324.
CCDB · book-ipcn73-74 — VALDES, B. 1973. Numeros cromosomicos de algunas plantas espanolas. Lagascalia 3: 211-217.
+40 more references
2n 281×CCDB · Cave1956supp
CCDB · Cave1956supp — Tateoka 1954
n 1019×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn66 +5
CCDB · iber-fl — Contribucin al conocimiento cariolgico de las Poaceae en Extremadura (Espaa). II. Devesa, J. A. & al.Bol. Soc. Brot. ser. 263: 153-205(1990).
CCDB · iber-fl — Recherches sur les liens de parent entre la flore orophile des Alpes et celledes Pyrnes. Kpfer, P.Boissiera23: 3-322(1974).
CCDB · ipcn-api-dl — Kockx-van Roon, M. & J. H. Wieffering. 1982. In IOPB chromosome number reports LXXV. Taxon 31: 367.
CCDB · ipcn-api-dl — Devesa, J. A., T. Luque & P. Gómez. 1990. Números cromosomáticos de plantas occidentales, 591--601. Anales Jard. Bot. Madrid 47: 411–417.
CCDB · ipcn-api-dl — Galland, N. 1988. Recherche sur l'origine de la flore orophile du Maroc étude caryologique et cytogéographique. Trav. Inst. Sci. Univ. Mohammed V, Sér. Bot. 35: 1–168.
CCDB · ipcn-api-dl — Devesa, J. A., T. RUIZ, A. Ortega, J. P. Carrasco, M. C. Viera, R. Torno & J. Pastor. 1990. Contribución al conocimiento cariológico de las Poaceae en Extremadura (Espana)---I. Bol. Soc. Brot., sér. 2 63: 29–66.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · book-ipcn66 — Polatschek 1966
CCDB · book-ipcn67-71 — KUPFER, P. 1968. Nouvelles prospections caryologiques dans le flore orophile des Pyrenees et de la Sierra Nevada. Bull. soc. Neuchateloise Sci. Nat. 91: 87-10~.
CCDB · book-ipcn75-78 — NA
CCDB · book-ipcn73-74 — KUPFER, P. 1974. Recherches sur les liens de parente entre la flore orophile des Alpes et celle des Pyrenees. Boissiera 23: 1-322.
CCDB · Cave1963 — Sorsa 1962
CCDB · CromoCat 2015 — Devesa, J. A., Luque, T. & Gómez, P. (1990c). Números cromosomáticos de plantas occidentales, 591-601. Anales Jard. Bot. Madrid 47: 411-417.
CCDB · CromoCat 2015 — Devesa, J. A., Ruiz, T., Ortega, A., Carrasco, J., Viera, M., Tormo, R. & Pastor, J. (1990a). Contribución al conocimiento cariológico de las Poaceae en Extremadura (España). II. Bol. Soc. Brot. 63: 153-205.
CCDB · CromoCat 2015 — Galland, N. (1988). Recherche sur l'origine de la flore orophile du Maroc: Étude caryologique et cytogéographique. Trav. Inst. Scientifique Rabat, sér. Bot. 35: 1-168.
CCDB · CromoCat 2015 — Küpfer, P. (1974). Recherches sur les liens de parenté entre la flore orophile des Alpes et celle des Pyrénées. Boissiera 23: 3- 322.
CCDB · CromoCat 2015 — Polatschek, A. (1965). Cytotaxonomische Beitrage zur Flora des Ostalpelander. Diss. Universität Wien pp. 130+X
CCDB · CromoCat 2015 — Polatschek, A. (1966b). Cytotaxonomische Beitrage zur Flora des Ostalpelander. II Österr. Bot. Z. 113(2): 101-147.
CCDB · CromoCat 2015 — Roon, M. K., van & J. H. Wieffering. (1982). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXV]. Taxon 31(2): 367.
n 53×CCDB · book-ipcn66 · CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74
CCDB · book-ipcn66 — Polatschek 1966
CCDB · book-ipcn67-71 — PASHUK, K.T. 1970. Cytological investigation of the Anthoxanthum genus in the Carpathians. Ukrajinsk. Bot. Zurn. 27: 439.
CCDB · book-ipcn73-74 — RITTER, J. 1974. In IO~B chromosome number reports XLIV. Taxon 23: 373-380.
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Chepinoga, V. V., Gnutikov, A. A., Moritz, R. S., Lubogoschinsky, P. I. & Sergeyeva, A. S. (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:892-894
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.960 ↗
polyploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
07Deep time~5.1 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin5.1 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type990 304 records
Wild obs. + sensor954 715
Museum / vouchered30 374
Cultivated / captive469
Other4 746
Origin
Native47 487
Introduced14 901
Range
Area of Occupancy AOO784 848 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy51% within 1 km
≤100 m 228 266≤1 km 173 214≤10 km 382 370>10 km 3 955
787 805 georeferenced · 166 910 without coordinates
Open the mapobservation + sensor954 715
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy39% within 1 km
≤100 m 2 569≤1 km 6 124≤10 km 12 759>10 km 662
22 114 georeferenced · 8 260 without coordinates
Open the institutions mapphysical evidence30 374
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy5% within 1 km
≤1 km 1≤10 km 5>10 km 15
21 georeferenced · 448 without coordinates
Open the mapnot free-living469
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions238 of 450 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 13 643 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 2 122 |
| BIO-UNIPIlocation not on record | 642 |
| Salzburg, AT | 601 |
| LDlocation not on record | 577 |
| Moscow State Universitylocation not on record | 502 |
| BFLlocation not on record | 453 |
| Olocation not on record | 428 |
| Uppsala, SE | 369 |
| Chongqing Museumlocation not on record | 281 |
| Berlin, DE | 276 |
| Philadelphia, US | 262 |
| MeiseBGlocation not on record | 239 |
| TROMlocation not on record | 223 |
| Sanda, JP | 192 |
| Bergen, NO | 185 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 181 |
| Saint Louis, US | 145 |
| Oskarshamn, SE | 139 |
| Museo Entomologico de Leonlocation not on record | 138 |
| SLU Artdatabankenlocation not on record | 133 |
| Bronx, US | 131 |
| Trondheim, NO | 129 |
| Adam Mickiewicz University in Poznańlocation not on record | 128 |
| Irkutsk State Universitylocation not on record | 126 |
| Christchurch, NZ | 125 |
| Garðabær, IS | 125 |
| Hobart, AU | 120 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 105 |
| Auckland, NZ | 103 |
| BDBClocation not on record | 95 |
| Barcelona, ES | 95 |
| Mount Annan, AU | 95 |
| KMNlocation not on record | 95 |
| Victoria, CA | 93 |
| University of Stellenboschlocation not on record | 90 |
| Canberra, AU | 90 |
| Entomological Society of Latvialocation not on record | 88 |
| Uniwersytet Warszawskilocation not on record | 88 |
| Adelaide, AU | 85 |
| MAlocation not on record | 85 |
| Jyväskylä, FI | 70 |
| Acadia Universitylocation not on record | 70 |
| New Haven, US | 69 |
| Fukushima Universitylocation not on record | 69 |
| Provincia di Livornolocation not on record | 68 |
| 68 | |
| National Biodiversity Institute, Costa Ricalocation not on record | 67 |
| Williamsburg, US | 67 |
| College Park, US | 66 |
| Wlocation not on record | 66 |
| WTUlocation not on record | 64 |
| Tallinn, EE | 63 |
| Kensington, AU | 61 |
| South Kensington, GB | 60 |
| Davis, US | 59 |
| Shinshu Universitylocation not on record | 58 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 58 |
| Québec, CA | 57 |
| GJOlocation not on record | 57 |
| University of New Hampshirelocation not on record | 57 |
| Arcata, US | 55 |
| Corvallis, US | 51 |
| Görlitz, DE | 51 |
| Vitoria, ES | 51 |
| Brisbane, AU | 51 |
| Chiba, JP | 50 |
| Universidad Nacional de Colombia (UNAL)location not on record | 50 |
| BRNUlocation not on record | 49 |
| Toyama, JP | 48 |
| Vancouver, CA | 48 |
| CASlocation not on record | 48 |
| Wellington, NZ | 47 |
| BClocation not on record | 45 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 44 |
| Bangkok, TH | 44 |
| Allentown, US | 43 |
| Tsukuba, JP | 42 |
| KURAlocation not on record | 41 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 41 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 40 |
| Odawara, JP | 39 |
| Bando, JP | 39 |
| Ann Arbor, US | 39 |
| Oulu, FI | 38 |
| Xiamen, CN | 36 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 35 |
| Uniwersytet Jagiellońskilocation not on record | 35 |
| Kew, GB | 35 |
| Columbia, US | 34 |
| Akita Prefectural Museumlocation not on record | 33 |
| CJBGlocation not on record | 32 |
| Chapel Hill, US | 31 |
| Madrid, ES | 31 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 30 |
| Madison, US | 30 |
| Mlocation not on record | 28 |
| Tartu, EE | 28 |
| Dresden, DE | 28 |
| Angwin, US | 27 |
| Bloomington, US | 25 |
| Salamanca, ES | 25 |
| Pullman, US | 25 |
| Aarhus, DK | 24 |
| Armidale, AU | 24 |
| Norfolk, US | 24 |
| Tomioka, JP | 23 |
| KIRMlocation not on record | 23 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 23 |
| CICYTEXlocation not on record | 22 |
| Kawasaki Shi Tama Ku, JP | 21 |
| Claremont, US | 21 |
| Zürich, CH | 21 |
| Bern, CH | 20 |
| Karlsruhe, DE | 20 |
| Saint John, CA | 20 |
| Montréal, CA | 20 |
| Millersville, US | 19 |
| Rotorua, NZ | 19 |
| Tampa, US | 19 |
| Porvoo, FI | 19 |
| Dover, US | 18 |
| Canadian Department of Agriculturelocation not on record | 18 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 17 |
| Kuopio, FI | 17 |
| Natural History Museum Rotterdamlocation not on record | 17 |
| BISHlocation not on record | 16 |
| Keene State Universitylocation not on record | 16 |
| John T. Waterhouse Herbariumlocation not on record | 16 |
| KOMlocation not on record | 16 |
| Frankfurt am Main | 16 |
| Portland, US | 15 |
| UGentlocation not on record | 15 |
| Badajoz, ES | 15 |
| Parkville, AU | 15 |
| Pamplona, ES | 15 |
| DBF-NHMDlocation not on record | 15 |
| San José, CR | 15 |
| Zürich, CH | 14 |
| nbflocation not on record | 14 |
| Burlington, US | 14 |
| Universidad de Caldas (UCaldas)location not on record | 13 |
| Université Lavallocation not on record | 13 |
| Moscow, US | 13 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 12 |
| Flagstaff, US | 12 |
| Universidad de La Salle (La Salle)location not on record | 12 |
| PRClocation not on record | 12 |
| Logan, US | 12 |
| Durham, US | 11 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 11 |
| QVMAGlocation not on record | 11 |
| Clemson, US | 11 |
| Paris, FR | 11 |
| Universidad del Quindío (UniQuindío)location not on record | 11 |
| Staten Island, US | 11 |
| PrivatHerblocation not on record | 11 |
| Porrentruy, CH | 11 |
| Kochi, JP | 10 |
| Turku, FI | 10 |
| Philadelphia, US | 10 |
| Tacoma, US | 10 |
| Pamplona, ES | 10 |
| BSBIlocation not on record | 10 |
| Hiratsuka City Museumlocation not on record | 10 |
| Toronto, CA | 10 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 9 |
| Tuscaloosa, US | 9 |
| Honolulu, US | 9 |
| Nishihara, JP | 9 |
| McWane Science Centerlocation not on record | 9 |
| Uniwersytet Śląski w Katowicachlocation not on record | 9 |
| QCNElocation not on record | 9 |
| Mexico City, MX | 9 |
| Beijing, CN | 9 |
| College of the Atlantic, Museumlocation not on record | 9 |
| San Isidro, AR | 9 |
| Museo Achille Folettolocation not on record | 9 |
| Stockholm, SE | 9 |
| Dekalb, US | 9 |
| Mohonk Preservelocation not on record | 9 |
| Loja, EC | 9 |
| Knoxville, US | 8 |
| Portland, US | 8 |
| Tula State Universitylocation not on record | 8 |
| GZUlocation not on record | 8 |
| University of Alberta Museumslocation not on record | 8 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 7 |
| Fairfax, US | 7 |
| Tilburg, NL | 7 |
| Bend, US | 7 |
| KMCClocation not on record | 7 |
| University of Tennessee at Chattanoogalocation not on record | 7 |
| Winterthur, CH | 7 |
| Riverside, US | 7 |
| Herb. BBGlocation not on record | 7 |
| Parthenon Tama History Museumlocation not on record | 6 |
| Toyota city nature sanctuarylocation not on record | 6 |
| Granada, ES | 6 |
| Université de Bordeauxlocation not on record | 6 |
| Göteborg, SE | 6 |
| Quito, EC | 6 |
| Provo, US | 6 |
| Alicante, ES | 6 |
| Blumenau, BR | 6 |
| ASUlocation not on record | 5 |
| Batemans Bay, AU | 5 |
| Fort Worth, US | 5 |
| Bourges, FR | 5 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 5 |
| BAYLUlocation not on record | 5 |
| Richmond, US | 5 |
| Tokushima, JP | 5 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 5 |
| GBR016location not on record | 5 |
| Johnson City, US | 5 |
| Brasília, BR | 5 |
| San Luis Obispo, US | 5 |
| PUC-RSlocation not on record | 5 |
| Mexico City, MX | 5 |
| Podgorica, ME | 5 |
| Nijmegen, NL | 5 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 5 |
| Gijón, ES | 5 |
| New Brunswick, US | 5 |
| Hudson, US | 4 |
| Whitewater, US | 4 |
| Fulda, DE | 4 |
| Palmerston, AU | 4 |
| La Trobe Universitylocation not on record | 4 |
| Durango, MX | 4 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 4 |
| Córdoba, ES | 4 |
| Canadian Museum of Nature, National Herbarium of Canadalocation not on record | 4 |
| UFSClocation not on record | 4 |
| Lord Fairfax Community Collegelocation not on record | 4 |
| UIBlocation not on record | 4 |
| Nagatoro-machi, Chichibu-gun, JP | 4 |
| Minia, EG | 4 |
| Naturalis Biodiversity Centerlocation not on record | 4 |
| Osaka, JP | 4 |
| Kushiro City Museumlocation not on record | 4 |
| SZUlocation not on record | 4 |
| San Jose, US | 4 |
| Pretoria, ZA | 4 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 4 |
| Philadelphia, US | 4 |
| Tromso University Museumlocation not on record | 4 |
| US | 4 |
| JP | 4 |
| JBRJlocation not on record | 4 |
| Glarus, CH | 4 |
| Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record | 4 |
| Portland, US | 4 |
| Obihiro Centennial City Museumlocation not on record | 4 |
| Iwate Prefectural Museumlocation not on record | 3 |
| CUVClocation not on record | 3 |
| Altos de Pipe, VE | 3 |
| National Institute of Biological Resourceslocation not on record | 3 |
| Asheville, US | 3 |
| FLADlocation not on record | 3 |
| SWlocation not on record | 3 |
| Boise, US | 3 |
| Little Rock, US | 3 |
| Green Bay, US | 3 |
| Universidad Industrial de Santander (UIS)location not on record | 3 |
| Whitehorse, CA | 3 |
| Valdosta State Universitylocation not on record | 3 |
| Hamilton, US | 3 |
| Otaru, JP | 3 |
| Kingston, US | 3 |
| Missoula, US | 3 |
| University of Southern Mississippilocation not on record | 3 |
| ISAlocation not on record | 3 |
| US | 3 |
| GINRlocation not on record | 3 |
| Anchorage, US | 3 |
| Namur, BE | 3 |
| Sagamihara, JP | 3 |
| Western Carolina Universitylocation not on record | 3 |
| BGR001location not on record | 3 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 3 |
| Ivano-Frankove, UA | 3 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 3 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 3 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 3 |
| Santa Cruz, US | 3 |
| Wollongong, AU | 3 |
| Northridge, US | 3 |
| Frauenfeld, CH | 3 |
| EL PASO, US | 3 |
| Fullerton, US | 3 |
| Kunming, CN | 3 |
| ZRC-SAZUlocation not on record | 3 |
| JBSlocation not on record | 3 |
| TAIElocation not on record | 3 |
| DOI/NPS, San Juan Island National Historical Parklocation not on record | 3 |
| Taipei, TW | 3 |
| SIHUlocation not on record | 3 |
| Washington, US | 3 |
| Santa Barbara, US | 3 |
| IPA/SPlocation not on record | 3 |
| Ciudad de México, MX | 3 |
| Austin, US | 3 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 3 |
| Sevilla, ES | 3 |
| Uniwersytet Opolskilocation not on record | 3 |
| HUAlocation not on record | 2 |
| Los Angeles, US | 2 |
| Universidad Católica de Oriente (UCO)location not on record | 2 |
| Monastir, TN | 2 |
| Phoenix, US | 2 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 2 |
| State Herbarium of South Australialocation not on record | 2 |
| Henderson State Universitylocation not on record | 2 |
| Wuzhou, CN | 2 |
| Maryland Department of Natural Resourceslocation not on record | 2 |
| Coimbra, PT | 2 |
| San Diego, US | 2 |
| Istituto Agrario Castelnuovolocation not on record | 2 |
| IDElocation not on record | 2 |
| Brussel, BE | 2 |
| DOI/NPS, Greenbelt Parklocation not on record | 2 |
| John May Museum of Natural Historylocation not on record | 2 |
| STUlocation not on record | 2 |
| Chengdu, CN | 2 |
| Denver, US | 2 |
| National Museum Waleslocation not on record | 2 |
| Jackson, US | 2 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 2 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 2 |
| Ciudad Autónoma de Buenos Aires, AR | 2 |
| CZE082location not on record | 2 |
| Museum of the Rockieslocation not on record | 2 |
| La Paz, BO | 2 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 2 |
| Royal Botanic Garden Edinburghlocation not on record | 2 |
| Taipei, TW | 2 |
| Fredericton Stock Culture Collectionlocation not on record | 2 |
| Ashland, US | 2 |
| Palmerston North, NZ | 2 |
| Smithfield, AU | 2 |
| Urumqi, CN | 2 |
| UNESP-RClocation not on record | 2 |
| Hunan Geological Museumlocation not on record | 2 |
| Corrientes, AR | 2 |
| Universiti Sains Malaysialocation not on record | 2 |
| Montecillo, Texcoco, MX | 2 |
| Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record | 2 |
| Pondicherry, IN | 2 |
| LfUlocation not on record | 2 |
| AASlocation not on record | 2 |
| Long Beach, US | 2 |
| Severin-McDaniel Insect Collectionlocation not on record | 2 |
| Bothell, US | 2 |
| China Agricultural Universitylocation not on record | 2 |
| Fayetteville, US | 2 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 2 |
| Universidade Federal de Santa Catarinalocation not on record | 2 |
| Buenos Aires, AR | 2 |
| Davenport, US | 2 |
| Ishikawa Museum of Natural Historylocation not on record | 2 |
| OLAlocation not on record | 2 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 2 |
| Omachi Alpine Museumlocation not on record | 2 |
| GAlocation not on record | 2 |
| Durham, US | 1 |
| IPE-CSIClocation not on record | 1 |
| ULBF-AGRlocation not on record | 1 |
| Baroda, IN | 1 |
| Durban, ZA | 1 |
| Xian, CN | 1 |
| Ural Federal University "B. N. Yeltsin"location not on record | 1 |
| Sant Julià de Lòria, AD | 1 |
| San Angelo, US | 1 |
| Sion, CH | 1 |
| Chadron, US | 1 |
| BioFokuslocation not on record | 1 |
| Cape Town, ZA | 1 |
| Pittsburg, US | 1 |
| University of Winnipeglocation not on record | 1 |
| UnBlocation not on record | 1 |
| Joondalup, AU | 1 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 1 |
| USP-IBlocation not on record | 1 |
| MEXUlocation not on record | 1 |
| Mérida, MX | 1 |
| Londrina, BR | 1 |
| AUAlocation not on record | 1 |
| St. Paul, US | 1 |
| Montréal, CA | 1 |
| GB | 1 |
| DULlocation not on record | 1 |
| Arequipa, PE | 1 |
| National Botanic Garden of Waleslocation not on record | 1 |
| Lubbock, US | 1 |
| Edmonton, CA | 1 |
| CEPLAClocation not on record | 1 |
| University of South Carolina Salkehatchielocation not on record | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| Jaén, ES | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Chicago, US | 1 |
| Uberlândia, BR | 1 |
| Brookings, US | 1 |
| UNINE:NEUlocation not on record | 1 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 1 |
| Cenit Transporte y Logística de Hidrocarburos S.A.S. (CENIT)location not on record | 1 |
| Guangzhou, CN | 1 |
| Universidad de Pamplona (UPamplona)location not on record | 1 |
| WINlocation not on record | 1 |
| Oswego, US | 1 |
| Royal British Columbia Museumlocation not on record | 1 |
| Tennessee Technological Universitylocation not on record | 1 |
| Chapingo, MX | 1 |
| Lausanne, CH | 1 |
| Museu Paraense Emílio Goeldilocation not on record | 1 |
| IAvHlocation not on record | 1 |
| LGlocation not on record | 1 |
| Nanjing, CN | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 1 |
| Nishihara, JP | 1 |
| Morelia, MX | 1 |
| Guasave, MX | 1 |
| DAOlocation not on record | 1 |
| Pennsylvania Department of Agriculturelocation not on record | 1 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 1 |
| HUN003location not on record | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| International Salmonella Centre (W.H.O.)location not on record | 1 |
| Clocation not on record | 1 |
| US | 1 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 1 |
| Universidad de Nariño (UdeNar)location not on record | 1 |
| Cambridge, US | 1 |
| BGBMlocation not on record | 1 |
| Plocation not on record | 1 |
| The Cattle Museumlocation not on record | 1 |
| Lincoln, US | 1 |
| Black Rock Forest Consortiumlocation not on record | 1 |
| Salvador, BR | 1 |
| Torreón, MX | 1 |
| CJBNlocation not on record | 1 |
| LUXEMBOURG, LU | 1 |
| BG-NMNHSlocation not on record | 1 |
| US | 1 |
| NoColllocation not on record | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| Uniwersytet w Białymstokulocation not on record | 1 |
450 institutions · 28 591 of 30 374 vouchered records shown · 1 551 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA44 detections
Where the DNA of Anthoxanthum odoratum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found44
Studies independent surveys1
Countries10
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 44 detections have coordinates
Open the map10 countries0
Botanic Gardencultivated in Botanic Garden; ORIGINAL_HABIT…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median12.0 °C -2.20–16.3
Seasonal swing summer↔winter13.9 °C
Max temp (day)14.9 °C 1.70–20.4
Min temp (night)9.00 °C -6.80–13.0
Precipitation70.7 mm/mo 36.6–101
Air humidity61.7 % 57.7–65.0
Moisture balance-12.2 mm/mo
Vapour deficit522 Pa 364–804
Wind speed4.20 m/s
Cloud cover46.3 % 37.9–63.5
CHELSA 1981–2010, ~9 km grid, at location & month of 35 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.