Anthoxanthum occidentale

(Buckley) Veldkamp · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Anthoxanthum

At a glance

Occurrence records795

Data sources11

Biological traits13

DNA specimens3

eDNA detections3

Sources11 archives

Databases and archives Anthoxanthum occidentale's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility795 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF795 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 42

01Narrative

Hierochloe occidentalis is a species of grass known by the common name California sweetgrass. It is a close relative of the more widely known sweet grass. It is native to the west coast of the United States from Washington to California, where it grows in the coniferous forests of the coastal mountain ranges. This is a rhizomatous perennial grass with leaves up to 30 centimeters long and 1.5 wide. The stem reaches a meter in height with an inflorescence of 7 to 10 centimeters. The spikelets grow on short, wavy stalks and each has three florets with long, protruding stamens during flowering.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.704 mg

⚠ sources differ — TRY: 0.704 mg · GIFT: 0.774 mg

Seed mass max1.26 mg

Seed mass min0.288 mg

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Graminoid

Woodinessnon-woody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthoxanthum occidentale has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences5

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMF374597.1 ↗386 bp

ACGT

TGTGCCAAGCTCGGGGATGCGGCTGGCTTGCTAACTGCCCCCCGTGCTGCAATGCTATTTAATCCACAGACTCTCGGCAACGGATATCTC …

Anthoxanthum occidentale isolate Hocci_H90 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Anthoxanthum occidentale carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 42 n = 21

Ploidypolyploid inferred

Chromosome records42–422n range42median42mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 424×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — Church (Myeri< 1947)

CCDB · book-fedorov — Anderson D. E.

CCDB · book-fedorov — D. n. 1965)

CCDB · book-atlas-flowering-plants — Fo

n 211×CCDB · book-ipcn65

CCDB · book-ipcn65 — Anderson 1965

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type795 records

Wild obs. + sensor647

Museum / vouchered148

Range

Area of Occupancy AOO1 256 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 358≤1 km 74≤10 km 41>10 km 22

495 georeferenced · 152 without coordinates

Open the mapobservation + sensor647

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy77% within 1 km

≤100 m 20≤1 km 59≤10 km 24

103 georeferenced · 45 without coordinates

Open the institutions mapphysical evidence148

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Arcata, US	41
Davis, US	31
San Luis Obispo, US	11
CASlocation not on record	11
US	10
Corvallis, US	7
Santa Cruz, US	4
Logan, US	4
Bronx, US	3
San Diego, US	3
University of Stellenboschlocation not on record	3
Tampa, US	3
Moscow, US	2
Ashland, US	2
Northridge, US	2
Severin-McDaniel Insect Collectionlocation not on record	2
San Angelo, US	1
Mexico City, MX	1
Uniwersytet Jagiellońskilocation not on record	1
Riverside, US	1
San Jose, US	1
Boise, US	1
Bloomington, US	1
Lubbock, US	1

24 institutions · 147 of 148 vouchered records shown · 1 without an institution code

09Environmental DNA3 detections

Where the DNA of Anthoxanthum occidentale was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)