Anthoxanthum gracile

Biv. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Anthoxanthum

At a glance

Occurrence records45

Data sources8

Biological traits9

DNA specimens3

eDNA detections3

Sources8 archives

Databases and archives Anthoxanthum gracile's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility45 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF45 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB9 Gbp

01Narrative

عشب الربيع الرشيق هو نوع من النباتات يتبع جنس عشب الربيع من الفصيلة النجيلية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction2

Life formannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthoxanthum gracile has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes1

GenBank sequences7

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKP295980.1 ↗607 bpItaly

ACGT

GTGACCCGTAACCAAAATAGACCGAGCACGCGTCATCCATCTTGCCGACGATGACATCGTTTGTCGTCTGGCCAAATCCTCAAACACCTC …

Anthoxanthum gracile voucher SANT:Pimentel & Sahuquillo 2009 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS7

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Anthoxanthum gracile carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size8 986 842 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Anthoxanthum gracile8.99 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 10 n = 5

Ploidydiploid inferred

Chromosome records10–102n range10median10mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 102×CCDB · ita-fl · CCDB · ipcn-api-dl

CCDB · ita-fl — DE LEONARDIS W., PAVONE P., TERRASI M.C., ZIZZA A. - 1983 (1981). Numeri cromosomici per la flora italiana:814-830.. Inform. Bot. Ital. , 13(2-3): 158-167.

CCDB · ipcn-api-dl — De Leonardis, W., P. Pavone, M. C. Terrasi & A. Zizza. 1981. Numeri cromosomici per la Flora Italiana: 814-830. Inform. Bot. Ital. 13: 158–167.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type45 records

Wild obs. + sensor2

Museum / vouchered39

Other4

Range

Area of Occupancy AOO152 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 1≤10 km 1

2 georeferenced · 37 without coordinates

Open the institutions mapphysical evidence39

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BIO-UNIPIlocation not on record	10
LDlocation not on record	9
Institut und Museum fuer Geologie und Palaeontologielocation not on record	4
Wlocation not on record	2
Paris, FR	1
Podgorica, ME	1
Oskarshamn, SE	1
BRNUlocation not on record	1
MAlocation not on record	1
Dresden, DE	1
Provincia di Livornolocation not on record	1
GZUlocation not on record	1
Santiago de Compostela, ES	1
Adam Mickiewicz University in Poznańlocation not on record	1

14 institutions · 35 of 39 vouchered records shown · 4 without an institution code

09Environmental DNA3 detections

Where the DNA of Anthoxanthum gracile was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)