Anthoxanthum aristatum
Boiss. · speciesAt a glance
Occurrence records15 014
Data sources10
Biological traits54
DNA specimens17
eDNA detections8
Sources10 archives
Databases and archives Anthoxanthum aristatum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility15 014 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics17 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources54 traits
Occurrence & distributionGBIF15 014 records
Environmental DNA1 datasets · 3 countries8 detections
DNA & barcodingBOLD · NCBI17 specimens
Genome at a glanceCCDB2n = 10
01Narrative
Slofhak is een eenjarige plant, die behoort tot de grassenfamilie (Poaceae). De soort staat op de Nederlandse Rode lijst van planten als vrij zeldzaam en zeer sterk afgenomen. Het aantal chromosomen is 2n = 10. De plant komt van nature voor in Eurazië. Slofhak heeft in tegenstelling tot gewoon reukgras een scherpe, niet zo aangename geur. Hij bloeit van mei tot juli.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYAusTraitsWCVP
Size & morphology21
Inflorescence length max5 cm
Inflorescence length min1 cm
Leaf length87.5 mm
Leaf length max60 mm
Leaf length min10 mm
Leaf mass11.63 mg
Leaf size358 mm²
Leaf width2.3 mm
⚠ sources differ — AusTraits: 2.3 mm · GIFT: 2 mm
Leaf width max3 mm
Leaf width min1 mm
Plant height0.156 m
⚠ sources differ — GIFT: 0.156 m · LEDA: 0.15 m · TRY: 0.19 m
Plant height generative0.229 m
Plant height max0.4 m
Plant height min0.04 m
Seed length1.2 mm
Seed length max1.2 mm
Seed length min1.2 mm
Seed mass0.225 mg
⚠ sources differ — TRY: 0.225 mg · LEDA: 0.225 mg · GIFT: 0.324 mg
Seed width0.7 mm
Seed width max0.7 mm
Seed width min0.7 mm
Life cycle & reproduction15
Deciduousnesspartly evergreen
Dispersal typeanimal
Flower length max2 mm
Flower length min1.6 mm
Flowering endJun
Flowering startMay
Life formannual
Life spanannual
Lifespan years1 years
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formtherophyte
Reproduction asexualabsent
Seed number657
Self fertilizationabsent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climatesubtropical
Climberself-supporting
Elevation max1 400 m
Elevation min400 m
Epiphyteterrestrial
Fruit typecaryopsis
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: Graminoid
Habitat GIFTmeadows, sand
Woodinessnon-woody
Physiology & chemistry3
Leaf dry-matter content (LDMC)228 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)31.22 mm²/mg
Other traits3
Diaspore typefruit with appendage
Inflorescencepanicle
Shoot orientationascending
05DNA & barcoding17 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthoxanthum aristatum has left across the world's sequence archives.
At a glance
DNA specimens17
Marker genes6
GenBank sequences10
eDNA detections8
Countries3
The DNA barcodea real sequence read deposited for this species
GTTGCGCCCGAGGTCTTTTGGCTGAGGGCACGCCTGCCTGGGCGTCACGCAAAACACGCTCCCAAACCCCTCGTTTGGGAATGGGATGCG …
Anthoxanthum aristatum voucher CCDB-24911-B05 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL1★rbcLa★ITS8★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Anthoxanthum aristatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 10 n = 5
Ploidydiploid inferred
Chromosome records10–202n range10median10mode28records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1026×CCDB · iber-fl · CCDB · nw-europe-fl · CCDB · poland +7
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. I. Gramineae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 243: 20-140(1969).
CCDB · iber-fl — Cytotaxonomy of spanish plants. II. Monocotyledons. Lve, A. & E. Kjellqvist.Lagascalia3(2): 147-182(1973).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4540
CCDB · poland — Pogan E., Jankun A., Wcis?o H. et al. 1988. Further studies in chromosome numbers of Polish Angiosperms. Part XXI. Acta Biol. Cracov. Ser. Bot. 30, 119-136.
CCDB · ipcn-api-dl — Pogan, E., A. Jankun & H. Wcis|1lo. 1989. Further studies in chromosome numbers of Polish angiosperms. Part XXI. Acta Biol. Cracov., Ser. Bot. 30: 119–136.
CCDB · ipcn-api-dl — Ko|3zuharov, S. I. & A. V. Petrova. 1991. Chromosome numbers of Bulgarian angiosperms. Fitologija 39: 72–77.
CCDB · ipcn-api-dl — Druskovic, B. & M. Lovka. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 15–19.
CCDB · ipcn-api-dl — Van Loon, J. C. 1980. In Chromosome number reports LXIX. Taxon 29: 718–720.
CCDB · book-ipcn67-71 — FERNANDES, A . & M. QUEIROS. 1969. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. I. Gramineae. Bol. Soc. Brat. 43(ser.2l: 3-140.
CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1973. Cytotaxonomy of Spanish plants. Monocotyledons. Lagascalia 3: 14 7-182. I
CCDB · book-ipcn73-74 — QUEIROS, M. 1973. Contribuicao para o conhecimento citotaxonomico dj spermatophyta de Portugal. I. Gramineae, Supl. I. Bol. Soc. Brot. I 4 7 ( Ser . 2 ) : 7 7- 1 0 3 .
CCDB · book-fedorov — ABAYJIOB 1928
CCDB · book-fedorov — Tischler 1934
CCDB · book-fedorov — Rohweder 1937
CCDB · book-fedorov — Millge 1939
CCDB · book-fedorov — Ostergren 1942
CCDB · book-fedorov — Borrill 1963
CCDB · book-fedorov — Jones K. 1964
CCDB · book-atlas-flowering-plants — Avdulov 1928
CCDB · Cave1963 — Mesquita 1963
CCDB · CromoCat 2015 — Druskovic, B. & Lovka, M. (1995). IOPB Chromosome Data 9 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 24: 15-19.
CCDB · CromoCat 2015 — Fernandes, A. & Queirós, M. (1969). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. I. Gramineae. Bol. Soc. Brot. 43: 20-140.
CCDB · CromoCat 2015 — Kozuharov, S. & Petrova, A. (1991). Chromosome numbers of Bulgarian Angiosperms. Fitologija 39: 72-77.
CCDB · CromoCat 2015 — Löve, A. & Kjellqvist, E. (1973). Cytotaxonomy of Spanish plants. II. Monocotyledons. Lagascalia 3(2): 147-182.
CCDB · CromoCat 2015 — Pogan, E., A. Jankun & H. Wcisllo (1989). Further studies in chromosome numbers of Polish angiosperms. Part XXI. Acta Biol. Cracov., Ser. Bot. 30: 119-136.
CCDB · CromoCat 2015 — Valdés, B. (1973a). Revisión de las especies anuales del género Anthoxanthum L. Lagascalia 3(1): 99-141.
2n 202×CCDB · iber-fl · CCDB · CromoCat 2015
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. I. Gramineae, supl. 1 Queirs, M.Bol. Soc. Brot. ser. 247: 77-103(1973).
CCDB · CromoCat 2015 — Queirós, M. (1973a). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. I. Gramineae, supl. 1. Bol. Soc. Brot. 47: 77-103.
n 102×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Devesa, J.A., Ruiz, T., Tormo, R., Muñoz, A., Viera, M. C., Carrasco, J., Ortega, A. & Pastor, J. (1990). Contribución al conocimiento cariológico de las Poaceae en Extremadura II. Bol. Soc. Brot., Sér. 2 63:153-205
CCDB · CromoCat 2015 — Devesa, J. A., Ruiz, T., Ortega, A., Carrasco, J., Viera, M., Tormo, R. & Pastor, J. (1990b). Contribucion al conocimiento cariológico de las Paoceae en Extremadura (España). I. Bol. Soc. Brot. 63: 29-66.
n 51×CCDB · Cave1963
CCDB · Cave1963 — Mesquita 1963
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type15 014 records
Wild obs. + sensor13 182
Museum / vouchered1 801
Cultivated / captive1
Other30
Origin
Native63
Introduced146
Range
Area of Occupancy AOO25 412 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy39% within 1 km
≤100 m 1 231≤1 km 3 409≤10 km 7 234>10 km 25
11 899 georeferenced · 1 283 without coordinates
Open the mapobservation + sensor13 182
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy37% within 1 km
≤100 m 34≤1 km 327≤10 km 607>10 km 21
989 georeferenced · 812 without coordinates
Open the institutions mapphysical evidence1 801
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 1 records without
Open the mapnot free-living1
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions80 of 146 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 517 |
| CICYTEXlocation not on record | 114 |
| Adam Mickiewicz University in Poznańlocation not on record | 58 |
| LDlocation not on record | 41 |
| Görlitz, DE | 34 |
| Uniwersytet Śląski w Katowicachlocation not on record | 33 |
| MAlocation not on record | 29 |
| Olocation not on record | 24 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 23 |
| Davis, US | 22 |
| UniKSlocation not on record | 19 |
| Berlin, DE | 18 |
| Dresden, DE | 17 |
| BFLlocation not on record | 16 |
| Entomological Society of Latvialocation not on record | 16 |
| BIO-UNIPIlocation not on record | 16 |
| Barcelona, ES | 15 |
| Museo Entomologico de Leonlocation not on record | 14 |
| Uniwersytet Jagiellońskilocation not on record | 14 |
| Jaén, ES | 14 |
| Nijmegen, NL | 14 |
| Badajoz, ES | 13 |
| Wlocation not on record | 11 |
| Vitoria, ES | 10 |
| MeiseBGlocation not on record | 10 |
| Salamanca, ES | 9 |
| Helsinki, FI | 9 |
| Claremont, US | 9 |
| Chapel Hill, US | 7 |
| Oskarshamn, SE | 7 |
| Madrid, ES | 7 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 7 |
| WTUlocation not on record | 7 |
| Museo Achille Folettolocation not on record | 7 |
| Uppsala, SE | 6 |
| Columbia, US | 6 |
| BClocation not on record | 6 |
| Tilburg, NL | 6 |
| Corvallis, US | 5 |
| CASlocation not on record | 5 |
| College of the Atlantic, Museumlocation not on record | 5 |
| Christchurch, NZ | 5 |
| Natural History Museum Rotterdamlocation not on record | 5 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 5 |
| Little Rock, US | 4 |
| Mlocation not on record | 4 |
| Bronx, US | 4 |
| Bourges, FR | 4 |
| Victoria, CA | 4 |
| Logan, US | 4 |
| Brussel, BE | 4 |
| Vancouver, CA | 4 |
| Hunan Geological Museumlocation not on record | 4 |
| Coimbra, PT | 4 |
| Jackson, US | 4 |
| Chongqing Museumlocation not on record | 4 |
| Tampa, US | 4 |
| Bloomington, US | 4 |
| Córdoba, ES | 4 |
| Philadelphia, US | 3 |
| BDBClocation not on record | 3 |
| DBF-NHMDlocation not on record | 3 |
| Bern, CH | 3 |
| Brisbane, AU | 3 |
| Canadian Department of Agriculturelocation not on record | 3 |
| Paris, FR | 3 |
| Oulu, FI | 3 |
| Frankfurt am Main | 3 |
| BRNUlocation not on record | 3 |
| Auckland, NZ | 3 |
| Jena Microbial Resource Collectionlocation not on record | 2 |
| Uniwersytet Opolskilocation not on record | 2 |
| Santa Barbara, US | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| South Kensington, GB | 2 |
| GAlocation not on record | 2 |
| University of Southern Mississippilocation not on record | 2 |
| Canberra, AU | 2 |
| Zürich, CH | 2 |
| Riverside, US | 2 |
| Wellington, NZ | 2 |
| SLU Artdatabankenlocation not on record | 2 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 2 |
| Adelaide, AU | 2 |
| Wuzhou, CN | 2 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 2 |
| Conway, US | 2 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 2 |
| University of British Columbia, Herbariumlocation not on record | 2 |
| DOI/NPS, Greenbelt Parklocation not on record | 2 |
| Nagano City, JP | 2 |
| València, ES | 2 |
| BG-NMNHSlocation not on record | 2 |
| Tall Timbers Research Stationlocation not on record | 1 |
| Henry Brockhouse Collectionlocation not on record | 1 |
| BSBIlocation not on record | 1 |
| Pamplona, ES | 1 |
| Burlington, US | 1 |
| Tromso University Museumlocation not on record | 1 |
| AUAlocation not on record | 1 |
| Zürich, CH | 1 |
| Mount Annan, AU | 1 |
| Granada, ES | 1 |
| Mississippi State, US | 1 |
| Tsukuba, JP | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Bend, US | 1 |
| Acadia Universitylocation not on record | 1 |
| UIBlocation not on record | 1 |
| LIVlocation not on record | 1 |
| Moscow, US | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| Saint Louis, US | 1 |
| San Luis Obispo, US | 1 |
| GBR016location not on record | 1 |
| PrivatHerblocation not on record | 1 |
| Göteborg, SE | 1 |
| Boumlocation not on record | 1 |
| H-Meierottlocation not on record | 1 |
| Kushiro City Museumlocation not on record | 1 |
| University of Stellenboschlocation not on record | 1 |
| Tuscaloosa, US | 1 |
| Norfolk, US | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| Chadron, US | 1 |
| Namur, BE | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Xiamen, CN | 1 |
| Fukushima Universitylocation not on record | 1 |
| Lord Fairfax Community Collegelocation not on record | 1 |
| Phoenix, US | 1 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 1 |
| Beijing, CN | 1 |
| Hobart, AU | 1 |
| Banyoles, ES | 1 |
| San Angelo, US | 1 |
| Due West, US | 1 |
| Chiba, JP | 1 |
| Fayetteville, US | 1 |
| Podgorica, ME | 1 |
| GJOlocation not on record | 1 |
| Fort Worth, US | 1 |
| Universität Erlangen-Nürnberglocation not on record | 1 |
| Bangkok, TH | 1 |
| Fulda, DE | 1 |
| Stockholm, SE | 1 |
146 institutions · 1 427 of 1 801 vouchered records shown · 352 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA8 detections
Where the DNA of Anthoxanthum aristatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found8
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 8 detections have coordinates
Open the map3 countries0
Dry sandy meadow foreshoreOn very thin soil over smooth sandstone slop…Seaside meadow, Abundant, dominant in shallo…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.5 °C 11.2–17.0
Seasonal swing summer↔winter14.6 °C
Max temp (day)17.6 °C 13.8–21.1
Min temp (night)11.2 °C 8.40–14.1
Precipitation60.4 mm/mo 39.7–73.4
Air humidity59.5 % 57.6–62.6
Vapour deficit609 Pa 528–826
Cloud cover41.7 % 36.8–48.7
CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.