Anthospermum aethiopicum

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Anthospermum

At a glance

Occurrence records798

Data sources11

Biological traits19

DNA specimens3

eDNA detections2

Sources11 archives

Databases and archives Anthospermum aethiopicum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility798 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources19 traits

Occurrence & distributionGBIF798 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Anthospermum aethiopicum is a species of flowering plant in the family Rubiaceae, indigenous to South Africa.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Plant height1.2 m

Plant height max2 m

Plant height min0.6 m

Seed mass0.49 mg

Seed mass max0.49 mg

Seed mass min0.49 mg

Life cycle & reproduction3

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max2 315 m

Elevation min10 m

Epiphyteterrestrial

Growth formshrub

Woodinessnon-woody

⚠ sources differ — TRY: non-woody · GIFT: woody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthospermum aethiopicum has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences10

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOR392090.1 ↗481 bp

ACGT

TCGAATCCTGCAAACGACCGCGAACAAGTTGATAACGCTCGGGGCGCCGTTCGCGGTGCCCCCTGCACAATCTAAACTCCCGGCGCGGAA …

Anthospermum aethiopicum voucher Muasya & Zhigila 7917 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL5★rbcLa★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Anthospermum aethiopicum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Puff, C. 1986. A biosystematic study of the African and Madagascan Rubiaceae--Anthospermeae. Pl. Syst. Evol., Suppl. 3: 1–535.

n 111×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Puff, C. 1986. A biosystematic study of the African and Madagascan Rubiaceae--Anthospermeae. Pl. Syst. Evol., Suppl. 3: 1–535.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type798 records

Wild obs. + sensor572

Museum / vouchered226

Range

Area of Occupancy AOO1 820 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 448≤1 km 38≤10 km 7>10 km 3

496 georeferenced · 76 without coordinates

Open the mapobservation + sensor572

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 224 without coordinates

Open the institutions mapphysical evidence226

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	116
Cape Town, ZA	60
Saint Louis, US	15
Bronx, US	7
GHPG$location not on record	5
Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record	5
MSB-3054location not on record	4
Civico Museo di Scienze naturali Giuseppe Orlandilocation not on record	3
Kew, GB	2
Paris, FR	1
South African Environmental Observations Networklocation not on record	1
Moscow State Universitylocation not on record	1
Philadelphia, US	1
STUlocation not on record	1

14 institutions · 222 of 226 vouchered records shown · 4 without an institution code

09Environmental DNA2 detections

Where the DNA of Anthospermum aethiopicum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 12.5–12.5

Seasonal swing summer↔winter7.20 °C

Max temp (day)14.2 °C

Min temp (night)10.6 °C

Precipitation236 mm/mo

Air humidity59.8 %

Moisture balance155 mm/mo

Vapour deficit580 Pa

Wind speed5.70 m/s

Cloud cover10.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)