Anthosachne solandri

(Steud.) Barkworth & S.W.L.Jacobs · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Anthosachne

At a glance

Occurrence records631

Data sources9

Biological traits26

DNA specimens0

eDNA detections1

Sources9 archives

Databases and archives Anthosachne solandri's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility631 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources26 traits

Occurrence & distributionGBIF631 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB · GoaT14 Gbp

01Narrative

Elymus solandri là một loài thực vật có hoa trong họ Hòa thảo. Loài này được (Steud.) Connor mô tả khoa học đầu tiên năm 1994.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology12

Leaf length max210 mm

Leaf width3 mm

Leaf width max3 mm

Leaf width min3 mm

Plant height0.7 m

Plant height max1 m

Seed length6.5 mm

Seed length max6.5 mm

Seed length min6.5 mm

Seed mass4.14 mg

Seed mass max4.14 mg

Seed mass min4.14 mg

Life cycle & reproduction6

Life formperennial

Life spanperennial

Pollination modeabiotic

Pollination syndromewind

Raunkiær life formhemicryptophyte

Reproduction asexualabsent

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTCoastal

Woodinessnon-woody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthosachne solandri has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY705895.1 ↗761 bpNew Zealand

ACGT

GGCGGTTCGCCGCCCCCGACGTCGCGAGAAGTCCATTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAA …

Elymus solandri voucher AK281159 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Anthosachne solandri carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size13 965 840 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Anthosachne solandri13.97 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 42 n = 21

Ploidy6× hexaploid · measured

Chromosome records42–422n range42median42mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 424×GoaT · Kew Plant DNA C-values Database · CCDB · new-zealand · CCDB · ipcn-api-dl +1

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · new-zealand

CCDB · ipcn-api-dl — Murray, B. G., P. J. de Lange & A. R. Ferguson. 2005. Nuclear DNA variation, chromosome numbers and polyploidy in the endemic and indigenous grass flora of New Zealand. Ann. Bot. (Oxford) 96: 1293–1305.

CCDB · kew — Murray BG, De Lange PJ, Ferguson AR. 2005. Nuclear DNA variation, chromosome numbers and polyploidy in the endemic and indigenous grass flora of New Zealand. Annals of Botany 96: 1293-1305.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

hexaploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type631 records

Wild obs. + sensor155

Museum / vouchered476

Range

Area of Occupancy AOO1 916 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 108≤1 km 12≤10 km 7>10 km 8

135 georeferenced · 20 without coordinates

Open the mapobservation + sensor155

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 9≤1 km 3≤10 km 1>10 km 1

14 georeferenced · 462 without coordinates

Open the institutions mapphysical evidence476

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	359
Auckland, NZ	73
Wellington, NZ	35
Rotorua, NZ	6
Saint Louis, US	3

5 institutions · 476 of 476 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Anthosachne solandri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.70 °C 5.70–5.70

Seasonal swing summer↔winter12.3 °C

Max temp (day)9.20 °C

Min temp (night)1.40 °C

Precipitation130 mm/mo

Air humidity62.6 %

Moisture balance54.3 mm/mo

Vapour deficit357 Pa

Wind speed5.90 m/s

Cloud cover38.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)