Anthosachne falcis

(Connor) Barkworth & S.W.L.Jacobs · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Anthosachne

At a glance

Occurrence records49

Data sources8

Biological traits18

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Anthosachne falcis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility49 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources18 traits

Occurrence & distributionGBIF49 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB · GoaT13.5 Gbp

01Narrative

Elymus falcis là một loài thực vật có hoa trong họ Hòa thảo. Loài này được Connor mô tả khoa học đầu tiên năm 1994.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Leaf length max100 mm

Plant height0.2 m

Plant height max0.35 m

Seed length6.25 mm

Seed length max6.25 mm

Seed length min6.25 mm

Life cycle & reproduction4

Life formperennial

Pollination modeabiotic

Pollination syndromewind

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTAlpine

Woodinessnon-woody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthosachne falcis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY705896.1 ↗761 bpNew Zealand

ACGT

GGCGGTTCGCCGCCCCCGACGTCGCGAGAAGTCCATTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAA …

Elymus falcis voucher AK286908 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Anthosachne falcis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size13 481 730 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Anthosachne falcis13.48 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 42 n = 21

Ploidy6× hexaploid · measured

Chromosome records42–422n range42median42mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 424×GoaT · Kew Plant DNA C-values Database · CCDB · new-zealand · CCDB · ipcn-api-dl +1

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · new-zealand

CCDB · ipcn-api-dl — Murray, B. G., P. J. de Lange & A. R. Ferguson. 2005. Nuclear DNA variation, chromosome numbers and polyploidy in the endemic and indigenous grass flora of New Zealand. Ann. Bot. (Oxford) 96: 1293–1305.

CCDB · kew — Murray BG, De Lange PJ, Ferguson AR. 2005. Nuclear DNA variation, chromosome numbers and polyploidy in the endemic and indigenous grass flora of New Zealand. Annals of Botany 96: 1293-1305.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

hexaploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type49 records

Wild obs. + sensor8

Museum / vouchered41

Range

Area of Occupancy AOO176 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 3>10 km 5

8 georeferenced

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 41 records without

Open the institutions mapphysical evidence41

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	34
Wellington, NZ	4
Auckland, NZ	1
Saint Louis, US	1
Rotorua, NZ	1

5 institutions · 41 of 41 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)