Anthophorula compactula

Cockerell, 1897 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Apidae/Anthophorula

At a glance

Occurrence records2 482

Data sources6

Biological traits1

DNA specimens14

eDNA detections1

Sources6 archives

Databases and archives Anthophorula compactula's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 482 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF2 482 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD14 specimens

01Narrative

Anthophorula compactula is een vliesvleugelig insect uit de familie bijen en hommels (Apidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1897 door Cockerell.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)1.63 mm

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthophorula compactula has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes2

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

12Tmostly conserved

14Amostly conserved

115Tvariable

163Amostly conserved

166Gmostly conserved

190Amostly conserved

226Tmostly conserved

316Tmostly conserved

416Gvariable

461Tmostly conserved

473Gmostly conserved

474Tmostly conserved

547Amostly conserved

553Tmostly conserved

625Tmostly conserved

628Tmostly conserved

TATGTTATATATAATTTTAGCTTTATGATCTGGAATAATTGGATCATCAATAAGATTTATTATTCGAATAGAATTAAGATCCCCTAATTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.56%

Haplotypes4

BIN1

Most divergent pair0.46%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthophorula completasame genus2.7%Anthophorula nitenssame genus8.2%Centris hoffmanseggiaesame family9.9%Xylocopa modestasame family10.8%Ashmeadiella bucconissame order10.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type2 482 records

Wild obs. + sensor2

Museum / vouchered2 480

Range

Area of Occupancy AOO928 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤1 km 3≤10 km 21

24 georeferenced · 2 456 without coordinates

Open the institutions mapphysical evidence2 480

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alabamalocation not on record	1 385
	504
Beltsville, US	443
Wuzhou, CN	107
WIlocation not on record	14
US	6
College Station, US	5
Washington, US	5
Albuquerque, US	3
Cambridge, US	2
San Diego, US	2
München, DE	2
Lubbock, US	1

13 institutions · 2 479 of 2 480 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Anthophorula compactula was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthophorula compactula

At a glance

Sources6 archives

Size & morphology1

At a glance

Record type2 482 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type2 482 records