Anthophora villosula

Smith, 1854 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Apidae/Anthophora

At a glance

Occurrence records1 238

Data sources7

Biological traits0

DNA specimens74

eDNA detections74

Sources7 archives

Databases and archives Anthophora villosula's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 238 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI74 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics74 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 238 records

Environmental DNA1 datasets · 2 countries74 detections

DNA & barcodingBOLD74 specimens

01Narrative

Anthophora villosula is a species of anthophorine bee in the family Apidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding74 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthophora villosula has left across the world's sequence archives.

At a glance

DNA specimens74

Marker genes2

eDNA detections74

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P1 143 bp consensus73 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

ACTGGTTGAACAGTTTATCCTCCTTTATCTTCATATTTATTTCATTCTTCTCCTTCTGTAGATATTACTATTTTTTCTTTACATTTATCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.12%

Haplotypes11

BINs0

Most divergent pair0.87%

AsiaN.America

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type1 238 records

Wild obs. + sensor874

Museum / vouchered364

Range

Area of Occupancy AOO1 844 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 435≤1 km 162≤10 km 36>10 km 97

730 georeferenced · 144 without coordinates

Open the mapobservation + sensor874

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 364 records without

Open the institutions mapphysical evidence364

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
US	211
WIlocation not on record	3
University Park, US	3
ZMAAlocation not on record	1

4 institutions · 218 of 364 vouchered records shown · 73 without an institution code

09Environmental DNA74 detections

Where the DNA of Anthophora villosula was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found74

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 74 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.0 °C 12.2–14.9

Seasonal swing summer↔winter22.4 °C

Max temp (day)18.3 °C 16.0–20.7

Min temp (night)9.50 °C 6.40–9.50

Precipitation104 mm/mo 90.0–141

Air humidity58.6 % 54.4–58.8

Moisture balance37.0 mm/mo -22.1–37.0

Vapour deficit697 Pa 585–773

Wind speed3.20 m/s 3.00–3.40

Cloud cover37.0 % 35.3–42.2

CHELSA 1981–2010, ~9 km grid, at location & month of 74 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthophora villosula

At a glance

Sources7 archives

At a glance

Record type1 238 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 4 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 238 records