Anthophagus alpinus

(Paykull, 1790) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Staphylinidae/Anthophagus

At a glance

Occurrence records1 807

Data sources6

Biological traits0

DNA specimens85

eDNA detections444

Sources6 archives

Databases and archives Anthophagus alpinus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 807 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI444 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics85 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 807 records

Environmental DNA3 datasets · 7 countries444 detections

DNA & barcodingBOLD85 specimens

01Narrative

Anthophagus alpinus is a species of rove beetles native to Europe.Fauna EuropaeaNorman H. Joy, , 1932 A Practical Handbook of British Beetles

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding85 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthophagus alpinus has left across the world's sequence archives.

At a glance

DNA specimens85

BINs2

Marker genes1

eDNA detections444

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus84 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 33 variable positions, in barcode order

1Tmostly conserved

4Avariable

82Tvariable

103Cmostly conserved

112Tvariable

124Avariable

142Amostly conserved

187Amostly conserved

217Cvariable

229Cvariable

265Gvariable

322Avariable

325Gvariable

340Avariable

397Cvariable

409Avariable

412Tvariable

475Avariable

493Avariable

496Tvariable

523Cvariable

526Cvariable

532Tvariable

535Gvariable

541Avariable

545Tvariable

547Avariable

553Cvariable

574Amostly conserved

613Cvariable

619Cvariable

625Amostly conserved

643Tvariable

TCTATATTTCATTTTTGGTGCATGAGCAGGTATAGTTGGAACATCCCTCAGAATTTTAATTCGTTCCGAACTTGGAAACCCTGGGTCATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.7%

Haplotypes39

BINs2

Most divergent pair17.6%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthophagus bicornissame genus10.3%Anthophagus alpestrissame genus10.7%Anthophagus angusticollissame genus11.0%Anthophagus fallaxsame genus11.0%Anthophagus praeustussame genus11.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 807 records

Wild obs. + sensor484

Museum / vouchered1 213

Fossil30

Other80

Range

Area of Occupancy AOO2 800 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 231≤1 km 159≤10 km 62

452 georeferenced · 32 without coordinates

Open the mapobservation + sensor484

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 615≤1 km 209≤10 km 232>10 km 31

1 087 georeferenced · 126 without coordinates

Open the institutions mapphysical evidence1 213

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Trondheim, NO	295
NTNU-VMlocation not on record	183
SLU Artdatabankenlocation not on record	156
Norwegian University of Life Sciences (NMBU)location not on record	107
Olocation not on record	63
Helsinki, FI	53
NHMOlocation not on record	48
Salzburg, AT	42
Tromsø, NO	41
Provincia di Livornolocation not on record	40
Metsähallituslocation not on record	23
Rovaniemi, FI	13
NMBU:MINAlocation not on record	13
LSMlocation not on record	11
Kuopio, FI	10
TMPMlocation not on record	9
BioFokuslocation not on record	6
CBDClocation not on record	4
MZLUlocation not on record	4
Adam Mickiewicz University in Poznańlocation not on record	4
Philadelphia, US	3
neflocation not on record	3
European Distributed Institute of Taxonomy (EDIT)location not on record	2
NMOKlocation not on record	2
ZSMlocation not on record	1
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	1
Natural History Museum, Londonlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
ZMAAlocation not on record	1
South Kensington, GB	1

30 institutions · 1 141 of 1 213 vouchered records shown · 72 without an institution code

09Environmental DNA444 detections

Where the DNA of Anthophagus alpinus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found444

Studies independent surveys3

Countries7

Verifiable raw sequence linked359

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 444 detections have coordinates

Open the map7 countries0

aus der Vegetation geklopft und gekeschertAlpine willow zonein einer Bachaue gekeschertauf einer alpinen Matte gekeschert

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.2 °C 8.20–14.1

Seasonal swing summer↔winter21.8 °C

Max temp (day)13.1 °C 10.3–17.5

Min temp (night)7.20 °C 4.50–9.20

Precipitation138 mm/mo 98.4–171

Air humidity63.0 % 59.6–65.7

Moisture balance51.9 mm/mo -2.40–68.9

Vapour deficit492 Pa 364–649

Wind speed3.20 m/s 1.50–5.60

Cloud cover62.2 % 37.9–63.4

CHELSA 1981–2010, ~9 km grid, at location & month of 443 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthophagus alpinus

At a glance

Sources6 archives

At a glance

Record type1 807 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 30 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 807 records