Anthonomus quadrigibbus

Say & T., 1832 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Curculionidae/Anthonomus

At a glance

Occurrence records860

Data sources5

Biological traits0

DNA specimens16

eDNA detections15

Sources5 archives

Databases and archives Anthonomus quadrigibbus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility860 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF860 records

Environmental DNA1 datasets · 2 countries15 detections

DNA & barcodingBOLD16 specimens

01Narrative

Anthonomus quadrigibbus, the apple curculio, is a species of true weevil in the beetle family Curculionidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthonomus quadrigibbus has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes1

eDNA detections15

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

23Gmostly conserved

85Gmostly conserved

217Amostly conserved

235Tmostly conserved

271Amostly conserved

316Avariable

416Amostly conserved

AACTTTATACTTCATTTTTGGGGCATGGTCAGGAACCGTAGGAACCTCCCTAAGAATACTAATTCGAACCGAACTAGGAACACCGGGCAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.30%

Haplotypes3

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthonomus rufussame genus15.3%Anthonomus rectirostrissame genus16.0%Anthonomus spilotussame genus16.1%Anthonomus pediculariussame genus16.7%Anthonomus chevrolatisame genus17.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type860 records

Wild obs. + sensor496

Museum / vouchered364

Range

Area of Occupancy AOO2 036 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 263≤1 km 56≤10 km 19>10 km 84

422 georeferenced · 74 without coordinates

Open the mapobservation + sensor496

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 46≤1 km 11≤10 km 28>10 km 26

111 georeferenced · 253 without coordinates

Open the institutions mapphysical evidence364

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
OSUClocation not on record	172
Denver, US	46
University of Alabamalocation not on record	46
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	27
ASUlocation not on record	16
Albany, US	11
Royal Saskatchewan Museumlocation not on record	11
University of Central Floridalocation not on record	7
University of Guelph, Centre for Biodiversity Genomicslocation not on record	5
CUlocation not on record	2
College Station, US	2
Wuzhou, CN	2
Colorado State Universitylocation not on record	2
St. Paul, US	2
Saint John, CA	2
Philadelphia, US	1

16 institutions · 354 of 364 vouchered records shown · 10 without an institution code

09Environmental DNA15 detections

Where the DNA of Anthonomus quadrigibbus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map2 countries0

Wetland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.1 °C 12.1–21.7

Seasonal swing summer↔winter26.4 °C

Max temp (day)21.5 °C 16.2–25.7

Min temp (night)13.0 °C 8.00–17.6

Precipitation92.5 mm/mo 84.7–131

Air humidity57.7 % 56.0–59.6

Moisture balance-32.0 mm/mo -57.7–1.70

Vapour deficit791 Pa 619–990

Wind speed3.10 m/s 2.60–4.00

Cloud cover45.5 % 36.6–49.7

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)