Anthonomus phyllocola

(J.F.W.Herbst, 1795) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Curculionidae/Anthonomus

At a glance

Occurrence records1 774

Data sources7

Biological traits0

DNA specimens23

eDNA detections36

Sources7 archives

Databases and archives Anthonomus phyllocola's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 774 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI36 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 774 records

Environmental DNA3 datasets · 7 countries36 detections

DNA & barcodingBOLD23 specimens

01Narrative

Anthonomus phyllocola is a weevil and a major pest of lodgepole pine (Pinus contorta) in Scandinavia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthonomus phyllocola has left across the world's sequence archives.

At a glance

DNA specimens23

BINs1

Marker genes1

eDNA detections36

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 18 variable positions, in barcode order

43Gvariable

46Cvariable

58Gmostly conserved

100Gvariable

106Tvariable

181Amostly conserved

184Amostly conserved

190Amostly conserved

208Avariable

232Cvariable

262Amostly conserved

307Gmostly conserved

316Gvariable

373Amostly conserved

376Avariable

406Tvariable

550Avariable

628Cmostly conserved

AACCTTATACTTCATCTTCGGGGCTTGATCAGGAACAGTAGGGACCTCCCTAAGAATGCTTATTCGCACTGAACTAGGAAACCCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes13

BIN1

Most divergent pair2.9%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthonomus rubidussame genus11.7%Anthonomus rufussame genus15.0%Anthonomus pediculariussame genus15.2%Anthonomus spilotussame genus15.2%Anthonomus conspersussame genus15.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 774 records

Wild obs. + sensor959

Museum / vouchered811

Cultivated / captive4

Range

Area of Occupancy AOO4 756 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 457≤1 km 280≤10 km 135>10 km 5

877 georeferenced · 82 without coordinates

Open the mapobservation + sensor959

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy70% within 1 km

≤100 m 235≤1 km 283≤10 km 194>10 km 27

739 georeferenced · 72 without coordinates

Open the institutions mapphysical evidence811

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	305
MNHWlocation not on record	55
Helsinki, FI	50
Trondheim, NO	33
Tartu, EE	32
Metsähallituslocation not on record	28
IFR-DNFlocation not on record	21
Salzburg, AT	19
NMBU:MINAlocation not on record	17
Natural History Museum Rotterdamlocation not on record	17
LSMlocation not on record	16
Muzeum Górnośląskie w Bytomiulocation not on record	11
NTNU-VMlocation not on record	10
UJAG-IZlocation not on record	10
Kuopio, FI	9
Philadelphia, US	9
Uniwersytet Wrocławskilocation not on record	8
Tallinn, EE	7
Olocation not on record	6
neflocation not on record	6
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	5
Tilburg, NL	5
MZLUlocation not on record	5
NHMOlocation not on record	4
ZSMlocation not on record	3
BioFokuslocation not on record	3
NMOKlocation not on record	2
University of Oulu, Zoological Museumlocation not on record	2
Stockholm, SE	2
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	2
Oulu, FI	2
Ugentlocation not on record	1
Uniwersytet Jagiellońskilocation not on record	1
CBDClocation not on record	1
TMPMlocation not on record	1
Rovaniemi, FI	1

36 institutions · 709 of 811 vouchered records shown · 102 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA36 detections

Where the DNA of Anthonomus phyllocola was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found36

Studies independent surveys3

Countries7

Verifiable raw sequence linked10

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 36 detections have coordinates

Open the map7 countries0

LaubwaldTrockener Mischwaldim Waldtien varren kuusetMischwaldKiefernbestand

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.60 °C 2.20–16.5

Seasonal swing summer↔winter18.7 °C

Max temp (day)12.9 °C 4.50–20.0

Min temp (night)5.60 °C -0.8–14.2

Precipitation55.8 mm/mo 33.8–87.7

Air humidity60.8 % 58.3–64.9

Moisture balance-25.9 mm/mo -54.8–12.6

Vapour deficit518 Pa 261–747

Wind speed3.40 m/s 2.40–4.80

Cloud cover43.6 % 36.6–52.6

CHELSA 1981–2010, ~9 km grid, at location & month of 36 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthonomus phyllocola

At a glance

Sources7 archives

At a glance

Record type1 774 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions11 of 36 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 774 records