Anthonomus grandis

Boheman, 1843 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Curculionidae/Anthonomus

At a glance

Occurrence records698

Data sources9

Biological traits0

DNA specimens207

eDNA detections156

Sources9 archives

Databases and archives Anthonomus grandis's data was compiled from.

WikipediaWikimedia Foundation10 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility698 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI156 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics207 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Occurrence & distributionGBIF698 records

Environmental DNA1 datasets · 2 countries156 detections

DNA & barcodingBOLD207 specimens

Genome at a glanceGoaT · TreeOfSex836 Mbp

01Narrative

The boll weevil (Anthonomus grandis) is a beetle that feeds on cotton buds and flowers. Thought to be native to Central Mexico, it migrated into the United States from Mexico in the late 19th century and had infested all U.S. cotton-growing areas by the 1920s, devastating the industry and the people working in the American South. During the late 20th century, it became a serious pest in South America as well. Since 1978, the Boll Weevil Eradication Program in the U.S. allowed full-scale cultivation to resume in many regions.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding207 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthonomus grandis has left across the world's sequence archives.

At a glance

DNA specimens207

BINs5

Marker genes3

eDNA detections156

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P408 bp consensus173 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 33 variable positions, in barcode order

28Amostly conserved

31Avariable

37Amostly conserved

58Cmostly conserved

64Cmostly conserved

66Cmostly conserved

69Cmostly conserved

97Tmostly conserved

100Tmostly conserved

103Avariable

127Cvariable

130Avariable

135Cmostly conserved

145Cvariable

148Avariable

169Amostly conserved

184Avariable

199Cmostly conserved

203Gmostly conserved

205Amostly conserved

229Tvariable

247Cmostly conserved

254Cvariable

268Amostly conserved

271Tvariable

280Gvariable

292Avariable

295Amostly conserved

340Tmostly conserved

343Tvariable

355Tvariable

404Cvariable

407Amostly conserved

TTTAATTTTAAGAAGAATTGTAAGAAAAGGAGCTGGAACAGGATGAACAGTTTACCCCCCACTCTCTTCTAATTTAGCTCATGAAGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 96 variants.

Diversity (π)3.0%

Haplotypes96

BINs5

Most divergent pair7.8%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Bradybatus fallaxsame family13.4%Anthonomus chevrolatisame genus14.0%Atractomerus caligatussame family15.3%Anthonomus pyrisame genus16.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS218S-5P

animal barcodefungal barcoderibosomal

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Anthonomus grandis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size836 190 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Anthonomus grandis0.84 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 42 n = 21

Ploidy2× diploid · measured

Chromosome records42–442n range43median42mode10records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 425×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · GoaT · Coleoptera Karyotype Database +1

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

TreeOfSex · invert — Lachowska D, Holecova M, Rozek M (1998) Karyotypic data on weevils (Coleoptera, Curculionidae). Folia Biologica-Krakow 46: 129-136. ↗

2n 445×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · GoaT · Coleoptera Karyotype Database +1

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

TreeOfSex · invert — McNally LR, Beck ML, Biggers CJ (2000) Karyotypic analysis of the cotton boll weevil, Anthonomus grandis Boheman. Genetica 109: 219-225. ↗

2n 432×GoaT · Animal Chromosome Counts Database · GoaT · Coleoptera Karyotype Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Coleoptera Karyotype Database

GoaT · Coleoptera Karyotype Database

08Occurrence & distribution

Record type698 records

Wild obs. + sensor21

Museum / vouchered677

Range

Area of Occupancy AOO584 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 5≤1 km 3≤10 km 7>10 km 1

16 georeferenced · 5 without coordinates

Open the mapobservation + sensor21

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy5% within 1 km

≤100 m 3≤1 km 21≤10 km 306>10 km 154

484 georeferenced · 193 without coordinates

Open the institutions mapphysical evidence677

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alabamalocation not on record	247
Juriquilla, MX	90
US	54
Lubbock, US	46
Natural History Museum of Utahlocation not on record	39
Instituto de Fitosanidad, Colegio de Postgraduados, Campus Montecillolocation not on record	34
Lexington, US	28
DPIlocation not on record	25
Albuquerque, US	24
ASUlocation not on record	19
Corporación Colombiana de Investigación Agropecuaria - AGROSAVIAlocation not on record	16
The University of the West Indies, Trinidad and Tobagolocation not on record	12
Albany, US	8
College Station, US	6
Mississippi State, US	5
University of Central Floridalocation not on record	4
PUC-RSlocation not on record	4
Mayagüez, PR	4
San Luis Potosí, MX	2
MX	2
Universidad Católica de Manizaleslocation not on record	1
Cambridge, US	1
Washington, US	1
CUlocation not on record	1
University Park, US	1

25 institutions · 674 of 677 vouchered records shown · 1 without an institution code

09Environmental DNA156 detections

Where the DNA of Anthonomus grandis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found156

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 156 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 12.5–15.7

Seasonal swing summer↔winter9.60 °C

Max temp (day)22.0 °C 18.4–22.0

Min temp (night)9.00 °C 8.20–9.00

Precipitation34.7 mm/mo 34.7–79.6

Air humidity50.9 % 50.9–57.3

Moisture balance-93.3 mm/mo -93.3–-38.4

Vapour deficit884 Pa 733–884

Wind speed4.10 m/s 4.10–5.80

Cloud cover25.5 % 25.5–36.7

CHELSA 1981–2010, ~9 km grid, at location & month of 41 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)