Anthomyia illocata

Walker, 1856 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Anthomyiidae/Anthomyia

At a glance

Occurrence records1 975

Data sources5

Biological traits0

DNA specimens26

eDNA detections51

Sources5 archives

Databases and archives Anthomyia illocata's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 975 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI51 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF1 975 records

Environmental DNA1 datasets · 8 countries51 detections

DNA & barcodingBOLD26 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthomyia illocata has left across the world's sequence archives.

At a glance

DNA specimens26

BINs2

Marker genes1

eDNA detections51

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus26 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

13Cmostly conserved

46Amostly conserved

88Avariable

214Gvariable

589Cmostly conserved

625Amostly conserved

AACTTTATATTTCATTTTTGGAGCTTGAGCAGGTATAGTAGGTACATCTTTAAGAATTTTAATTCGAGCAGAATTAGGTCATCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.62%

Haplotypes5

BINs2

Most divergent pair3.2%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthomyia silvestrissame genus4.3%Verticia orientalissame order7.4%Hylemyza partitasame family7.9%Alliopsis freyisame family8.0%Stomorhina lunatasame order8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 975 records

Wild obs. + sensor1 954

Museum / vouchered21

Range

Area of Occupancy AOO5 656 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 896≤1 km 212≤10 km 104>10 km 258

1 470 georeferenced · 484 without coordinates

Open the mapobservation + sensor1 954

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 21 records without

Open the institutions mapphysical evidence21

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
NSMKlocation not on record	18
Zoological Museum, University of Amoylocation not on record	1
KCMNlocation not on record	1
University of Central Floridalocation not on record	1

4 institutions · 21 of 21 vouchered records shown

09Environmental DNA51 detections

Where the DNA of Anthomyia illocata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found51

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 51 detections have coordinates

Open the map8 countries0

1. Forest & Woodland | 1.6. Subtropical/Trop…8. Desert | 8.1. Hot Desert1. Forest & Woodland1. Forest & Woodland | 1.5. Subtropical/Trop…1. Forest & Woodland|1.5. Subtropical/Tropic…Urban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.9 °C 10.0–28.6

Seasonal swing summer↔winter22.0 °C

Max temp (day)24.2 °C 15.7–33.4

Min temp (night)13.6 °C 3.10–21.2

Precipitation40.1 mm/mo 13.8–185

Air humidity51.6 % 45.5–63.8

Moisture balance-67.2 mm/mo -110–51.1

Vapour deficit993 Pa 602–1,786

Wind speed2.00 m/s 1.30–4.50

Cloud cover36.2 % 21.3–49.3

CHELSA 1981–2010, ~9 km grid, at location & month of 47 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthomyia illocata

At a glance

Sources5 archives

At a glance

Record type1 975 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 975 records