Anthocoris musculus

(Say, 1832) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Anthocoridae/Anthocoris

At a glance

Occurrence records727

Data sources6

Biological traits0

DNA specimens181

eDNA detections181

Sources6 archives

Databases and archives Anthocoris musculus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility727 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI181 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics181 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF727 records

Environmental DNA1 datasets · 2 countries181 detections

DNA & barcodingBOLD181 specimens

01Narrative

Anthocoris musculus is a species of minute pirate bug in the family Anthocoridae. It is found in Europe & Northern Asia (excluding China) and North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding181 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthocoris musculus has left across the world's sequence archives.

At a glance

DNA specimens181

BINs1

Marker genes1

eDNA detections181

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus168 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

220Cvariable

268Amostly conserved

340Cmostly conserved

371Gmostly conserved

382Tmostly conserved

427Gvariable

541Gmostly conserved

TTTATATTTTATATTTGGAATATGAGCAGGAATATTAGGAACATCTCTTAGATGAATTATTCGAATTGAACTAGGACAACCTGGATCTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.34%

Haplotypes8

BIN1

Most divergent pair1.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthocoris antevolenssame genus3.3%Temnostethus gracilissame family10.4%Anthocoris limbatussame genus10.4%Anthocoris nemorumsame genus11.2%Anthocoris hsiaoisame genus11.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type727 records

Wild obs. + sensor8

Museum / vouchered719

Range

Area of Occupancy AOO776 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 2≤1 km 1≤10 km 1>10 km 2

6 georeferenced · 2 without coordinates

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy93% within 1 km

≤100 m 217≤1 km 45≤10 km 17>10 km 2

281 georeferenced · 438 without coordinates

Open the institutions mapphysical evidence719

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Edmonton, CA	264
Vancouver, CA	216
University of Guelph, Centre for Biodiversity Genomicslocation not on record	99
Champaign, US	10
University of Guelphlocation not on record	5
Universidad Católica de Manizaleslocation not on record	4
Chicago, US	2
DOI/FWS, Kenai National Wildlife Refugelocation not on record	1
University of Alaska Museumlocation not on record	1

9 institutions · 602 of 719 vouchered records shown · 117 without an institution code

09Environmental DNA181 detections

Where the DNA of Anthocoris musculus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found181

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 181 detections have coordinates

Open the map2 countries0

Mixed habitat4. Native GrasslandMixed Habitat17. Other1. Forest|1.2 Subarctic ForestForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.0 °C 5.10–16.5

Seasonal swing summer↔winter28.7 °C

Max temp (day)16.7 °C 11.1–22.0

Min temp (night)6.60 °C 0.3–11.6

Precipitation55.6 mm/mo 35.1–107

Air humidity57.0 % 53.4–61.3

Moisture balance-32.4 mm/mo -62.6–14.4

Vapour deficit568 Pa 397–788

Wind speed2.90 m/s 2.00–4.40

Cloud cover41.9 % 37.1–54.1

CHELSA 1981–2010, ~9 km grid, at location & month of 177 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)