Anthocharis midea

(Hübner, 1809) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pieridae/Anthocharis

At a glance

Occurrence records4 881

Data sources7

Biological traits0

DNA specimens29

eDNA detections41

Sources7 archives

Databases and archives Anthocharis midea's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 881 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI41 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 881 records

Environmental DNA1 datasets · 2 countries41 detections

DNA & barcodingBOLD29 specimens

01Narrative

Anthocharis midea, the falcate orangetip, is a North American butterfly that was described in 1809 by Jacob Hübner. It belongs to the family Pieridae, which is the white and sulphurs. These butterflies are mostly seen in the eastern United States, and in Texas and Oklahoma. They eat the nectar of violets and mustards. They tend to live in open, wet woods along waterways, in open swamps, and less often in dry woods and ridgetops. This species is a true springtime butterfly, being on the wing from April to May (March to May in southern Texas).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthocharis midea has left across the world's sequence archives.

At a glance

DNA specimens29

BINs1

Marker genes1

eDNA detections41

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

238Tmostly conserved

271Tvariable

307Tvariable

364Tmostly conserved

382Tmostly conserved

412Tmostly conserved

421Cmostly conserved

442Cvariable

469Gmostly conserved

622Gmostly conserved

AACTTTATACTTTATTTTTGGGATCTGATCAGGAATAGTAGGAACTTCTCTTAGTTTACTAATTCGAACTGAATTAGGAAATCCTGGCTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.66%

Haplotypes16

BIN1

Most divergent pair1.2%

OtherN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthocharis cethurasame genus6.2%Euchloe lottasame family6.5%Euchloe guaymasensissame family6.5%Euchloe olympiasame family6.7%Euchloe hyantissame family6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type4 881 records

Wild obs. + sensor4 063

Museum / vouchered818

Range

Area of Occupancy AOO9 844 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 1 600≤1 km 872≤10 km 452>10 km 260

3 184 georeferenced · 879 without coordinates

Open the mapobservation + sensor4 063

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy18% within 1 km

≤100 m 11≤1 km 110≤10 km 459>10 km 86

666 georeferenced · 152 without coordinates

Open the institutions mapphysical evidence818

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	340
Cambridge, US	81
East Lansing, US	67
Georgia Museum of Natural Historylocation not on record	53
Cleveland Museum of Natural History, OH (CLEV)location not on record	35
Washington, US	32
Blacksburg, US	27
Natural History Museum of Utahlocation not on record	20
Mississippi State, US	20
Denver, US	13
Toronto, CA	11
CUlocation not on record	8
St. Paul, US	8
UDlocation not on record	6
King Saud Universitylocation not on record	6
Denton, US	5
Zürich, CH	5
Smithsonian Institution, National Museum of Natural Historylocation not on record	5
Sam Noble Oklahoma Museum of Natural Historylocation not on record	5
OSUClocation not on record	2
Cornell University Insect Collectionlocation not on record	2
Tartu, EE	2
Philadelphia, US	2
Colorado State University, C. P. Gillette Museum of Arthropod Diversitylocation not on record	1
Brussels, BE	1
University of Alberta Museums (UAM)location not on record	1
RBINS-Scientific Heritagelocation not on record	1

27 institutions · 759 of 818 vouchered records shown · 59 without an institution code

09Environmental DNA41 detections

Where the DNA of Anthocharis midea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found41

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 41 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.3 °C 12.7–17.1

Seasonal swing summer↔winter22.4 °C

Max temp (day)19.0 °C 16.6–22.6

Min temp (night)10.2 °C 8.60–12.6

Precipitation94.3 mm/mo 84.2–106

Air humidity55.8 % 54.1–68.2

Moisture balance-18.2 mm/mo

Vapour deficit663 Pa 615–834

Wind speed5.70 m/s

Cloud cover41.0 % 22.8–46.5

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthocharis midea

At a glance

Sources7 archives

At a glance

Record type4 881 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 27 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 881 records