Anthocercis littorea

Labill. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Solanales/Solanaceae/Anthocercis

At a glance

Occurrence records601

Data sources7

Biological traits30

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Anthocercis littorea's data was compiled from.

GBIFGlobal Biodiversity Information Facility601 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources30 traits

Occurrence & distributionGBIF601 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 72

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology12

Fruit length14 mm

Leaf length35 mm

Leaf mass per area126 g/m2

Leaf size2 224 mm²

Leaf width13.5 mm

Plant height3 m

Plant height max3 m

Plant height min0.6 m

Seed length1.7 mm

Seed mass0.58 mg

⚠ sources differ — TRY: 0.58 mg · AusTraits: 0.543 mg · GIFT: 0.58 mg

Seed mass max0.58 mg

Seed mass min0.58 mg

Life cycle & reproduction5

Flowering timeyyyyyyyyyyyy

Life formshrub

Life spanperennial

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Leaf shapenarrowly_obovate obovate spathulate

Woodinesswoody

Physiology & chemistry2

Leaf n19.24 mg/g

Leaf p0.675 mg/g

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthocercis littorea has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

matKAJ585860.1 ↗1 553 bp

ACGT

CAAATGAAAGAAATCCAAAGATATTTACAGCCAGATAGATCGCAACAACACAACTTCCTATATCCACTTATCTTTCAGGAGTATATTTAT …

Anthocercis littorea plastid matK gene for maturase K

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Anthocercis littorea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 72 n = 36

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 361×CCDB · solan

CCDB · solan

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type601 records

Wild obs. + sensor184

Museum / vouchered412

Cultivated / captive5

Origin

Native54

Range

Area of Occupancy AOO1 348 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 86≤1 km 42≤10 km 5>10 km 10

143 georeferenced · 41 without coordinates

Open the mapobservation + sensor184

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤100 m 33≤1 km 45≤10 km 232>10 km 19

329 georeferenced · 83 without coordinates

Open the institutions mapphysical evidence412

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 4

4 georeferenced · 1 without coordinates

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	160
Museo Entomologico de Leonlocation not on record	63
Mount Annan, AU	54
Adelaide, AU	52
Canberra, AU	42
Brisbane, AU	8
Hobart, AU	5
Palmerston, AU	5
Claremont, US	4
Kew, GB	3
BGPAlocation not on record	3
Stockholm, SE	2
Joondalup, AU	2
Armidale, AU	2
Córdoba, AR	2
Paris, FR	1
John T. Waterhouse Herbariumlocation not on record	1
MAlocation not on record	1
Wlocation not on record	1

19 institutions · 411 of 412 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Anthocercis littorea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)