Anthias woodsi

Anderson & Heemstra, 1980 · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Serranidae/Anthias

At a glance

Occurrence records114

Data sources8

Biological traits6

DNA specimens4

eDNA detections3

Sources8 archives

Databases and archives Anthias woodsi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility64 records↗

OBISOcean Biodiversity Information System50 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS114 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD4 specimens

01Narrative

Anthias woodsi is een straalvinnige vissensoort uit de familie van zaag- of zeebaarzen (Serranidae). De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 1980 door Anderson & Heemstra.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length20.8 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Other traits3

Depth max421 m

Depth min256 m

Vulnerability15.38

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthias woodsi has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P1 557 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.04%

Haplotypes2

BIN1

Most divergent pair0.06%

Where individuals differ — all 1 variable positions, in barcode order

135Avariable

ATACCTGCCCTGCCCACACGTTGAATTTTTTCAACCAACCACAAAGACATCGGGACCCTTTATCTAGTATTTGGTGCTTGAGCAGGAATG …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_083044 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTBrrn12rrn16

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type114 records

Wild obs. + sensor14

Museum / vouchered100

Range

Area of Occupancy AOO192 km²

Depth

0–200 m sunlit0

200–1000 m twilight10

1–4 km midnight0

>4 km abyssal0

median 325 m · max 384 m · 10 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy25% within 1 km

≤100 m 1>10 km 3

4 georeferenced · 10 without coordinates

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy6% within 1 km

≤1 km 2≤10 km 2>10 km 32

36 georeferenced · 64 without coordinates

Open the institutions mapphysical evidence100

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	24
Washington, US	16
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	10
Chicago, US	3
New Haven, US	2
North Carolina Museum of Natural Scienceslocation not on record	1
FishBaselocation not on record	1

7 institutions · 57 of 100 vouchered records shown · 2 without an institution code

09Environmental DNA3 detections

Where the DNA of Anthias woodsi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)