Antheraea semperi

Felder, 1861 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Saturniidae/Antheraea

At a glance

Occurrence records7

Data sources6

Biological traits0

DNA specimens44

eDNA detections42

Sources6 archives

Databases and archives Antheraea semperi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI42 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics44 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF7 records

Environmental DNA1 datasets · 1 countries42 detections

DNA & barcodingBOLD44 specimens

01Narrative

Antheraea semperi is een vlinder uit de familie nachtpauwogen (Saturniidae), onderfamilie Saturniinae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd door C. & R. Felder in 1861.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding44 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antheraea semperi has left across the world's sequence archives.

At a glance

DNA specimens44

BINs3

Marker genes1

eDNA detections42

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus40 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

34Amostly conserved

40Tmostly conserved

85Cvariable

106Cvariable

169Tmostly conserved

193Tmostly conserved

202Tvariable

250Tvariable

271Cmostly conserved

295Amostly conserved

319Tvariable

340Tmostly conserved

400Tvariable

433Gvariable

460Tvariable

520Gvariable

523Cvariable

616Cmostly conserved

634Cvariable

646Cvariable

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCTTTAAGACTTCTAATTCGAGCAGAATTAGGAACCCCCGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes14

BINs3

Most divergent pair8.4%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Antheraea gschwandnerisame genus2.0%Antheraea pedunculatasame genus2.3%Antheraea platessasame genus2.3%Antheraea raffrayisame genus2.3%Antheraea sumatranasame genus2.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type7 records

Wild obs. + sensor7

Range

Area of Occupancy AOO16 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 5

6 georeferenced · 1 without coordinates

Open the mapobservation + sensor7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA42 detections

Where the DNA of Antheraea semperi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found42

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 42 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.0 °C 19.9–27.5

Seasonal swing summer↔winter2.30 °C

Max temp (day)27.8 °C 22.9–29.0

Min temp (night)24.0 °C 16.3–26.6

Precipitation190 mm/mo 75.1–371

Air humidity67.7 % 63.1–73.8

Moisture balance49.8 mm/mo

Vapour deficit1,054 Pa 730–1,340

Wind speed5.60 m/s

Cloud cover40.3 % 28.5–50.0

CHELSA 1981–2010, ~9 km grid, at location & month of 33 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)