Antheraea knyvetti

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Saturniidae/Antheraea

At a glance

Occurrence records6

Data sources5

Biological traits0

DNA specimens38

eDNA detections38

Sources5 archives

Databases and archives Antheraea knyvetti's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI38 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics38 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF6 records

Environmental DNA1 datasets · 6 countries38 detections

DNA & barcodingBOLD38 specimens

01Narrative

Antheraea knyvetti is een vlinder uit de familie nachtpauwogen (Saturniidae), onderfamilie Saturniinae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd door Hampson in 1893.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding38 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antheraea knyvetti has left across the world's sequence archives.

At a glance

DNA specimens38

BINs1

Marker genes1

eDNA detections38

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus34 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

220Tmostly conserved

280Gmostly conserved

286Avariable

287Tvariable

295Tmostly conserved

412Gmostly conserved

436Avariable

478Tvariable

610Cmostly conserved

616Cmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCTTTAAGACTTCTAATTCGAGCAGAATTAGGAACCCCAGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.64%

Haplotypes9

BIN1

Most divergent pair1.5%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Antheraea korintjianasame genus4.4%Antheraea royliisame genus4.4%Antheraea pahangensissame genus4.6%Antheraea vietnamensissame genus4.6%Antheraea lampeisame genus4.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type6 records

Wild obs. + sensor4

Museum / vouchered2

Range

Area of Occupancy AOO20 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 2>10 km 1

3 georeferenced · 1 without coordinates

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Research Collection of Rodolphe Rougerielocation not on record	1
Research Collection of Eric Van Schaycklocation not on record	1

2 institutions · 2 of 2 vouchered records shown

09Environmental DNA38 detections

Where the DNA of Antheraea knyvetti was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found38

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 38 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.8 °C 14.8–23.1

Seasonal swing summer↔winter10.7 °C

Max temp (day)21.2 °C 17.7–25.0

Min temp (night)14.2 °C 9.20–19.5

Precipitation248 mm/mo 55.6–673

Air humidity71.6 % 63.5–77.2

Moisture balance159 mm/mo -29.2–564

Vapour deficit587 Pa 425–878

Wind speed1.40 m/s 0.8–2.80

Cloud cover49.1 % 30.4–75.0

CHELSA 1981–2010, ~9 km grid, at location & month of 29 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)