Anthemis tomentosa

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Anthemis

At a glance

Occurrence records281

Data sources8

Biological traits7

DNA specimens6

eDNA detections1

Sources8 archives

Databases and archives Anthemis tomentosa's data was compiled from.

GBIFGlobal Biodiversity Information Facility281 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources7 traits

Occurrence & distributionGBIF281 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 18

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height0.3 m

Seed mass0.25 mg

Life cycle & reproduction1

Raunkiær life formtherophyte

Habitat & environment4

Aquaticterrestrial

Climatesubtropical

Growth formherb

⚠ sources differ — GIFT: herb · TRY: annual forb

Woodinessnon-woody

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthemis tomentosa has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes3

GenBank sequences1

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

ITSFM957759.1 ↗540 bpTurkey

ACGT

TCGAACCCTGCAAAGCAGAACGACCCGCGAACACGTAAAACAACCGAGCGTCGAGTGAATTGAGGTGTTTGATATTCGAAGGTTCGGTGA …

Anthemis tomentosa partial ITS1 and ITS2, specimen voucher W:1995-07769

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Anthemis tomentosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 185×CCDB · ita-fl · CCDB · fl-europaea · CCDB · ipcn-api-dl

CCDB · ita-fl — BRULLO S., GUGLIELMO A., PAVONE P., TERRASI M.C. - 1992 (1991). Numeri cromosomici per la flora italiana: 1251-1266.. Inform. Bot. Ital. , 23(1): 39-47.

CCDB · fl-europaea — Carpineri, 1971

CCDB · ipcn-api-dl — Stephanov, G. 1982. In IOPB chromosome number reports LXXVII. Taxon 31: 764.

CCDB · ipcn-api-dl — Brullo, S., A. Guglielmo, P. Pavone & M. C. Terrasi. 1991. Numeri cromosomici per la flora Italiana: 1251--1266. Inform. Bot. Ital. 23: 39–46.

CCDB · ipcn-api-dl — Van Loon, J. C. & H. C. M. Snelders. 1979. In IOPB chromosome number reports LXV. Taxon 28: 632–634.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type281 records

Wild obs. + sensor116

Museum / vouchered163

Other2

Range

Area of Occupancy AOO796 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 42≤1 km 36≤10 km 2>10 km 13

93 georeferenced · 23 without coordinates

Open the mapobservation + sensor116

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 162 without coordinates

Open the institutions mapphysical evidence163

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	102
Berlin, DE	53
Dresden, DE	1
Paris, FR	1
Görlitz, DE	1
Moscow State Universitylocation not on record	1
Wlocation not on record	1
Frankfurt am Main	1

8 institutions · 161 of 163 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Anthemis tomentosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.4 °C 10.4–10.4

Seasonal swing summer↔winter24.2 °C

Max temp (day)15.7 °C

Min temp (night)3.20 °C

Precipitation42.3 mm/mo

Air humidity54.3 %

Moisture balance-49.4 mm/mo

Vapour deficit708 Pa

Wind speed2.70 m/s

Cloud cover34.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)