Anthemis punctata

Vahl · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Anthemis

At a glance

Occurrence records323

Data sources8

Biological traits18

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Anthemis punctata's data was compiled from.

GBIFGlobal Biodiversity Information Facility323 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements2 literature sources18 traits

Occurrence & distributionGBIF323 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 36

02Traits & measurements

SourcesWCVPGIFT

Size & morphology8

Leaf length max120 mm

Leaf width55 mm

Leaf width max55 mm

Leaf width min55 mm

Plant height max0.6 m

Seed length3 mm

Seed length max3 mm

Seed length min3 mm

Life cycle & reproduction5

Dispersal typewind

Life formperennial

Life spanperennial

Raunkiær life formphanerophyte

Reproduction asexualabsent

Habitat & environment4

Climatesubtropical

Growth formherb

Habitat GIFTLowland

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthemis punctata has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences5

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSFM957779.1 ↗552 bpTunisia

ACGT

TCGAACCCTGCAAAGCAGAACGACCCGCGAACACGTAAAACAACAGAGCATCGAGTGAATTAAGGTTTGTTTGATACACTCGATGCTTCG …

Anthemis punctata partial ITS1 and ITS2, specimen voucher personal collection:C.Oberprieler:6771

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS5★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Anthemis punctata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidypolyploid inferred

Chromosome records18–362n range36median36mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 362×CCDB · ita-fl · CCDB · ipcn-api-dl

CCDB · ita-fl — CAPINERI R. - 1968. Cariologia di alcune specie di "Anthemis".. Giorn. Bot. Ital. , 102(6): 548.

CCDB · ipcn-api-dl — Oberprieler, C. 1998. The systematics of Anthemis L. (Compositae, Anthemideae) in W and C North Africa. Bocconea 9: 1–328.

2n 181×CCDB · nw-europe-fl

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4056

n 181×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Oberprieler, C. 1998. The systematics of Anthemis L. (Compositae, Anthemideae) in W and C North Africa. Bocconea 9: 1–328.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type323 records

Wild obs. + sensor311

Museum / vouchered12

Origin

Native2

Introduced147

Range

Area of Occupancy AOO716 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy21% within 1 km

≤100 m 32≤1 km 33≤10 km 246

311 georeferenced

Open the mapobservation + sensor311

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 1

2 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	5
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
Paris, FR	1
Barcelona, ES	1
Moscow State Universitylocation not on record	1
BClocation not on record	1

6 institutions · 11 of 12 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Anthemis punctata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.4 °C 20.4–20.4

Seasonal swing summer↔winter18.6 °C

Max temp (day)25.5 °C

Min temp (night)14.3 °C

Precipitation14.6 mm/mo

Air humidity53.4 %

Moisture balance-130 mm/mo

Vapour deficit1,202 Pa

Wind speed4.50 m/s

Cloud cover25.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)