Anthemis cretica

(L.) L. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Anthemis

At a glance

Occurrence records729

Data sources9

Biological traits24

DNA specimens4

eDNA detections6

Sources9 archives

Databases and archives Anthemis cretica's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility729 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

Paleobiology DatabasePBDB consortiumfossil record↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources24 traits

Chemical compositionNPASS36 compounds

Occurrence & distributionGBIF729 records

Environmental DNA1 datasets · 3 countries6 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Anthemis abrotanifolia là một loài thực vật có hoa trong họ Cúc. Loài này được (Willd.) Guss. mô tả khoa học đầu tiên năm 1844.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology7

Leaf size138 mm²

Plant height0.128 m

Plant height max0.25 m

Plant height min0.05 m

Seed mass0.482 mg

⚠ sources differ — TRY: 0.482 mg · GIFT: 0.52 mg

Seed mass max0.52 mg

Seed mass min0.52 mg

Life cycle & reproduction5

Flowering endAug

Flowering startJul

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Growth formherb

Habitat GIFTforest, mountains

Mycorrhiza typenon-mycorrhizal

Woodinessnon-woody

Physiology & chemistry6

Leaf C:N ratio18.85 g/g

Leaf c459 mg/g

Leaf dry-matter content (LDMC)170 mg/g

Leaf n24.44 mg/g

Leaf p2.0 mg/g

Specific leaf area (SLA)13.96 mm²/mg

03Chemical composition36 compounds

Compounds documented for Anthemis cretica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavones14

Monosaccharides4

Flavonols3

Eudesmane sesquiterpenoids1

Caryophyllane sesquiterpenoids1

Documented compounds36 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,4R)-1-(beta-D-Glucopyranosyloxy)-4-hydroxy-2-cyclopentene-1-carbonitrile	present	NPASS
(1R,4S,6R,10S)-4,12,12-trimethyl-9-methylidene-5-oxatricyclo[8.2.0.04,6]dodecane	present	NPASS
(1S)-1,5-anhydro-2-O-(6-deoxy-beta-L-mannopyranosyl)-1-[5,7-dihydroxy-2-(4-hydroxyphenyl)-4-oxo-4H-chromen-8-yl]-D-glucitol	present	NPASS
(2S)-pinocembrin	present	NPASS
(4aS,5S)-3-(2-hydroxypropan-2-yl)-4a,5-dimethyl-5,6,7,8-tetrahydronaphthalen-2-one	present	NPASS
(E)-3-[2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-4-oxochromen-8-yl]prop-2-enoic acid	present	NPASS
2-(3,4-dihydroxy-5-methoxyphenyl)-5,7-dihydroxy-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]oxan-2-yl]oxychromen-4-one	present	NPASS
4'-Methylgenkwanin	present	NPASS
5,4'-Dihydroxy-7,3'-dimethoxyflavone	present	NPASS
5,7-dihydroxy-2-(4-hydroxy-3,5-dimethoxyphenyl)-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]oxan-2-yl]oxychromen-4-one	present	NPASS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthemis cretica has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences10

eDNA detections6

Countries3

The DNA barcodea real sequence read deposited for this species

ITSON619971.1 ↗617 bpItaly

ACGT

TCGAACCCTGCAAAGCAGAACGACCCGTGAACAGTAAAACAACGAGCGTCGAGTGAATTAAGGTTTGTTTGATTGCACTCGATGCTCTGT …

Anthemis cretica isolate A0729 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS9★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type729 records

Wild obs. + sensor642

Museum / vouchered85

Cultivated / captive1

Other1

Origin

Introduced1

Range

Area of Occupancy AOO1 116 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy8% within 1 km

≤100 m 24≤1 km 15≤10 km 461>10 km 11

511 georeferenced · 131 without coordinates

Open the mapobservation + sensor642

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy68% within 1 km

≤100 m 5≤1 km 8≤10 km 6

19 georeferenced · 66 without coordinates

Open the institutions mapphysical evidence85

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	18
Berlin, DE	17
BRNUlocation not on record	9
Wlocation not on record	6
BIO-UNIPIlocation not on record	4
Salamanca, ES	3
Bourges, FR	3
Institut und Museum fuer Geologie und Palaeontologielocation not on record	3
BG-NMNHSlocation not on record	3
Barcelona, ES	2
MAlocation not on record	2
Moscow State Universitylocation not on record	2
Dresden, DE	2
Oskarshamn, SE	1
Paris, FR	1
BDBClocation not on record	1
Görlitz, DE	1
Saint Louis, US	1
Uppsala, SE	1
Göteborg, SE	1
València, ES	1

21 institutions · 82 of 85 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA6 detections

Where the DNA of Anthemis cretica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 11.3–17.0

Seasonal swing summer↔winter16.2 °C

Max temp (day)18.5 °C 15.1–19.5

Min temp (night)9.00 °C 7.30–14.9

Precipitation55.2 mm/mo 42.2–76.5

Air humidity62.5 % 56.7–62.8

Moisture balance-51.6 mm/mo -57.7–-8.00

Vapour deficit758 Pa 552–875

Wind speed3.00 m/s 2.40–4.60

Cloud cover38.3 % 38.3–41.8

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)