Anthemis cotula
speciesAt a glance
Occurrence records33 450
Data sources10
Biological traits74
DNA specimens26
eDNA detections14
Sources10 archives
Databases and archives Anthemis cotula's data was compiled from.
GBIFGlobal Biodiversity Information Facility33 450 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics26 specimens↗
NCBIUS National Library of Medicinesequences↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
Traits & measurements5 literature sources74 traits
Chemical compositionNPASS3 compounds
Occurrence & distributionGBIF33 450 records
Environmental DNA1 datasets · 7 countries14 detections
DNA & barcodingBOLD · NCBI26 specimens
Genome at a glanceGIFT · GoaT4.1 Gbp
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology25
Fruit length1.5 mm
⚠ sources differ — AusTraits: 1.5 mm · GIFT: 2 mm
Fruit length max2 mm
Fruit length min1.2 mm
Fruit width0.8 mm
Leaf length50 mm
Leaf length max80 mm
Leaf length min6 mm
Leaf mass6.17 mg
Leaf size138 mm²
Leaf width17.5 mm
Leaf width max20 mm
Leaf width min5 mm
Plant height0.345 m
⚠ sources differ — GIFT: 0.345 m · AusTraits: 0.6 m · LEDA: 0.285 m · TRY: 0.409 m
Plant height generative0.318 m
Plant height max0.6 m
Plant height min0.1 m
Seed length2 mm
⚠ sources differ — TRY: 2 mm · GIFT: 1.5 mm
Seed length max1.5 mm
Seed length min1.5 mm
Seed mass0.444 mg
Seed mass max0.45 mg
Seed mass min0.37 mg
Seed volume0.36 mm³
Seed volume max0.36 mm³
Seed volume min0.36 mm³
Life cycle & reproduction19
Deciduousnessevergreen
⚠ sources differ — TRY: evergreen · GIFT: deciduous
Dehiscenceindehiscent
Dispersal typehuman
⚠ sources differ — LEDA: agochor · GIFT: unspecialized
Flower colourwhite
Flower width max25 mm
Flower width min15 mm
Flowering endSep
Flowering startJun
Flowering timeyyyynnnnnnyy
Life formannual or biennial
Life spanannual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproduction asexualabsent
Seed number3 500
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment16
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 100 m
Elevation min0 m
Epiphyteterrestrial
Fruit colourbrown
Fruit fleshinessdry
Fruit typeachene
Growth formherb
Habitat GIFTLowland
Leaf compoundnesssimple
Leaf formlinear
Leaf shapeobovate ovate
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry7
Leaf C:N ratio14.7 g/g
Leaf c432 mg/g
Leaf dry-matter content (LDMC)167 mg/g
⚠ sources differ — TRY: 167 mg/g · LEDA: 107 mg/g
Leaf n32.81 mg/g
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)26.7 mm²/mg
⚠ sources differ — TRY: 26.7 mm²/mg · LEDA: 22.4 mm²/mg · GIFT: 22.4 mm²/mg
Other traits5
Diaspore typefruit
Leaf arrangementalternate
Plant support typefree-standing
Seeds per fruit>1000
Shoot orientationerect
03Chemical composition3 compounds
Compounds documented for Anthemis cotula across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile2 classes
Aporphine alkaloids $ Isoquinoline alkaloids2
Aporphine alkaloids1
Documented compounds3 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| Liriodenine | present | NPASS | |
| O-Methylmoschatoline | present | NPASS | |
| Oxoxylopine | present | NPASS |
05DNA & barcoding26 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthemis cotula has left across the world's sequence archives.
At a glance
DNA specimens26
Marker genes7
GenBank sequences10
eDNA detections14
Countries8
The DNA barcodea real sequence read deposited for this species
GTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTTTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC …
Anthemis cotula voucher PLT.0607 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL5★rbcLa★trnL-F★ITS5★ITS2cp-trnL-intron
plant barcodefungal barcodemarker
06Genome at a glanceGIFT · GoaT
The complete instruction manual Anthemis cotula carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size4 083 150 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Anthemis cotula4.08 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Chromosome records18–182n range18median18mode2records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 182×GoaT · DTOL Flowering Plants Estimates Kew · GIFT · GIFT (floras)
GoaT · DTOL Flowering Plants Estimates Kew
GIFT · GIFT (floras)
08Occurrence & distribution
Record type33 450 records
Wild obs. + sensor26 511
Museum / vouchered6 778
Cultivated / captive22
Other139
Origin
Native219
Introduced2 757
Range
Area of Occupancy AOO74 876 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy26% within 1 km
≤100 m 2 796≤1 km 3 093≤10 km 16 720>10 km 263
22 872 georeferenced · 3 639 without coordinates
Open the mapobservation + sensor26 511
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy43% within 1 km
≤100 m 281≤1 km 1 262≤10 km 1 811>10 km 225
3 579 georeferenced · 3 199 without coordinates
Open the institutions mapphysical evidence6 778
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1>10 km 15
16 georeferenced · 6 without coordinates
Open the mapnot free-living22
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions224 of 370 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 195 |
| BFLlocation not on record | 192 |
| LDlocation not on record | 191 |
| Madison, US | 173 |
| Philadelphia, US | 162 |
| Moscow State Universitylocation not on record | 141 |
| Québec, CA | 132 |
| Uppsala, SE | 121 |
| Chongqing Museumlocation not on record | 120 |
| BIO-UNIPIlocation not on record | 116 |
| UChlocation not on record | 111 |
| BRNUlocation not on record | 105 |
| San Diego, US | 98 |
| Bergen, NO | 92 |
| Berlin, DE | 91 |
| Bronx, US | 87 |
| MeiseBGlocation not on record | 82 |
| Olocation not on record | 74 |
| Córdoba, AR | 74 |
| Riverside, US | 74 |
| WTUlocation not on record | 72 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 68 |
| Görlitz, DE | 65 |
| St. Paul, US | 63 |
| Wuzhou, CN | 63 |
| Corvallis, US | 63 |
| Claremont, US | 61 |
| Entomological Society of Latvialocation not on record | 60 |
| Bloomington, US | 59 |
| Mount Annan, AU | 58 |
| Barcelona, ES | 58 |
| DBF-NHMDlocation not on record | 57 |
| Museo Entomologico de Leonlocation not on record | 56 |
| Davis, US | 56 |
| Pullman, US | 55 |
| Trondheim, NO | 52 |
| Auckland, NZ | 51 |
| Santa Barbara, US | 48 |
| Ann Arbor, US | 47 |
| Vitoria, ES | 47 |
| València, ES | 46 |
| Oskarshamn, SE | 45 |
| San Isidro, AR | 45 |
| Zürich, CH | 43 |
| San Luis Obispo, US | 42 |
| Adam Mickiewicz University in Poznańlocation not on record | 41 |
| BDBClocation not on record | 41 |
| Jaén, ES | 39 |
| Montréal, CA | 39 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 39 |
| Oulu, FI | 39 |
| MAlocation not on record | 37 |
| Burlington, US | 37 |
| Chapel Hill, US | 36 |
| Saint Louis, US | 35 |
| Logan, US | 34 |
| Wellington, NZ | 34 |
| Bern, CH | 33 |
| University of New Hampshirelocation not on record | 33 |
| SLU Artdatabankenlocation not on record | 32 |
| New Haven, US | 31 |
| Turku, FI | 30 |
| Canadian Department of Agriculturelocation not on record | 29 |
| Nagano City, JP | 29 |
| Allentown, US | 29 |
| Moscow, US | 28 |
| Christchurch, NZ | 28 |
| US | 28 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 28 |
| Vancouver, CA | 28 |
| CASlocation not on record | 27 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 27 |
| Green Bay, US | 26 |
| Salzburg, AT | 26 |
| CICYTEXlocation not on record | 26 |
| Salamanca, ES | 26 |
| Toronto, CA | 25 |
| South Kensington, GB | 25 |
| IFR-DNFlocation not on record | 25 |
| Bangkok, TH | 24 |
| Pretoria, ZA | 24 |
| Córdoba, ES | 24 |
| Badajoz, ES | 23 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 23 |
| Acadia Universitylocation not on record | 23 |
| Fort Worth, US | 22 |
| BClocation not on record | 21 |
| San Sebastián, ES | 20 |
| Arcata, US | 20 |
| College of the Atlantic, Museumlocation not on record | 19 |
| Odawara, JP | 19 |
| College Park, US | 19 |
| University of Stellenboschlocation not on record | 19 |
| Helsinki, FI | 18 |
| Dekalb, US | 17 |
| GJOlocation not on record | 17 |
| Saint John, CA | 17 |
| Adelaide, AU | 17 |
| Pamplona, ES | 16 |
| Zürich, CH | 16 |
| Paris, FR | 15 |
| Jackson, US | 15 |
| Tsukuba, JP | 15 |
| Mlocation not on record | 14 |
| Wlocation not on record | 14 |
| Shinshu Universitylocation not on record | 13 |
| Irvine, US | 13 |
| Portland, US | 13 |
| Canberra, AU | 12 |
| Granada, ES | 12 |
| TUR-Alocation not on record | 12 |
| Madrid, ES | 12 |
| KIRMlocation not on record | 12 |
| UGentlocation not on record | 12 |
| Los Angeles, US | 11 |
| Flagstaff, US | 11 |
| KMNlocation not on record | 11 |
| ASUlocation not on record | 11 |
| Hobart, AU | 11 |
| Laboratory of Palaeontologylocation not on record | 11 |
| Staten Island, US | 11 |
| Rotorua, NZ | 11 |
| ISAlocation not on record | 11 |
| Austin, US | 10 |
| Davenport, US | 10 |
| US | 10 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 10 |
| Tokushima, JP | 10 |
| Angwin, US | 9 |
| Université Lavallocation not on record | 9 |
| Bozeman, US | 9 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 9 |
| Kew, GB | 9 |
| Mississippi State, US | 8 |
| US | 8 |
| Fayetteville, US | 8 |
| Turlock, US | 8 |
| Missoula, US | 8 |
| Pamplona, ES | 8 |
| Williamsburg, US | 8 |
| Tuscaloosa, US | 8 |
| Tomioka, JP | 8 |
| Northridge, US | 7 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 7 |
| Long Beach, US | 7 |
| Chiba, JP | 7 |
| Jena Microbial Resource Collectionlocation not on record | 7 |
| San Francisco, US | 7 |
| Porrentruy, CH | 7 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 6 |
| GMBAlocation not on record | 6 |
| DOI/NPS, Greenbelt Parklocation not on record | 6 |
| EL PASO, US | 6 |
| Jyväskylä, FI | 6 |
| Valparaiso, CL | 6 |
| Catalina Island Conservancylocation not on record | 6 |
| AUAlocation not on record | 6 |
| Columbia, US | 6 |
| CJBGlocation not on record | 6 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 6 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 6 |
| Pocatello, US | 6 |
| Knoxville, US | 6 |
| Valparaíso, CL | 6 |
| Hiratsuka City Museumlocation not on record | 6 |
| Denton, US | 5 |
| Nagatoro-machi, Chichibu-gun, JP | 5 |
| WINlocation not on record | 5 |
| Boise, US | 5 |
| Nishihara, JP | 5 |
| US | 5 |
| Cape Town, ZA | 5 |
| Frauenfeld, CH | 5 |
| Whitewater, US | 5 |
| Uniwersytet Warszawskilocation not on record | 5 |
| Bourges, FR | 5 |
| Spearfish, US | 5 |
| Toyama, JP | 5 |
| Phyletisches Museum Jenalocation not on record | 5 |
| IDElocation not on record | 5 |
| Brisbane, AU | 5 |
| Miami, US | 5 |
| Otaru, JP | 5 |
| No collectionlocation not on record | 5 |
| Tartu, EE | 5 |
| Kushiro City Museumlocation not on record | 5 |
| Gijón, ES | 5 |
| University of Alberta Museumslocation not on record | 5 |
| Santa Cruz, US | 4 |
| Severin-McDaniel Insect Collectionlocation not on record | 4 |
| McWane Science Centerlocation not on record | 4 |
| Fulda, DE | 4 |
| Istituto Agrario Castelnuovolocation not on record | 4 |
| Caldwell, US | 4 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 4 |
| Porto Alegre, BR | 4 |
| University of Wisconsinlocation not on record | 4 |
| SIHUlocation not on record | 4 |
| Ciudad Autónoma de Buenos Aires, AR | 4 |
| Waverly, US | 4 |
| Castelar, AR | 4 |
| Armidale, AU | 4 |
| BSBIlocation not on record | 4 |
| GB | 4 |
| Coimbra, PT | 4 |
| JP | 4 |
| Palacký University in Olomouclocation not on record | 4 |
| PRClocation not on record | 3 |
| National Institute of Biological Resourceslocation not on record | 3 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 3 |
| Clemson, US | 3 |
| Philadelphia, US | 3 |
| PrivatHerblocation not on record | 3 |
| UIBlocation not on record | 3 |
| Tennessee Technological Universitylocation not on record | 3 |
| Tacoma, US | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| New Brunswick, US | 3 |
| Ensenada, MX | 3 |
| Victoria, CA | 3 |
| Corrientes, AR | 3 |
| Viña del Mar, CL | 3 |
| Western Carolina Universitylocation not on record | 3 |
| Denver, US | 3 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 3 |
| Palmerston North, NZ | 3 |
| Sanda, JP | 3 |
| Frankfurt am Main | 3 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 3 |
| Tallinn, EE | 3 |
| Provo, US | 3 |
| H-AkrKGlocation not on record | 3 |
| Millersville, US | 3 |
| San Jose, US | 2 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 2 |
| H-Adlerlocation not on record | 2 |
| Parthenon Tama History Museumlocation not on record | 2 |
| Kirksville, US | 2 |
| UnBlocation not on record | 2 |
| Appalachian State Universitylocation not on record | 2 |
| Hudson, US | 2 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 2 |
| Tampa, US | 2 |
| Bend, US | 2 |
| John T. Waterhouse Herbariumlocation not on record | 2 |
| University of Guelph, OAC Herbariumlocation not on record | 2 |
| Tilburg, NL | 2 |
| Herbario Universidad de Concepciónlocation not on record | 2 |
| Winterthur, CH | 2 |
| QVMAGlocation not on record | 2 |
| Lake Charles, US | 2 |
| TROMlocation not on record | 2 |
| Natural History Museum Rotterdamlocation not on record | 2 |
| Parkville, AU | 2 |
| Brussel, BE | 2 |
| Arizona State University Biocollectionslocation not on record | 2 |
| Chadron, US | 2 |
| Tall Timbers Research Stationlocation not on record | 2 |
| Nijmegen, NL | 2 |
| FLADlocation not on record | 2 |
| Oswego, US | 2 |
| Emporia, US | 2 |
| Université de Bordeauxlocation not on record | 2 |
| GZUlocation not on record | 2 |
| Russellville, US | 2 |
| Kuopio, FI | 2 |
| Pittsburg, US | 2 |
| Dresden, DE | 2 |
| Lord Fairfax Community Collegelocation not on record | 2 |
| Durban, ZA | 2 |
| Weber State Universitylocation not on record | 2 |
| University of Southern Mississippilocation not on record | 2 |
| Cheney, US | 2 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 2 |
| Museum of the Rockieslocation not on record | 2 |
| Springfield, US | 2 |
| Alicante, ES | 2 |
| Albuquerque, US | 2 |
| Chicago, US | 2 |
| Kunming, CN | 1 |
| Royal Botanical Gardenslocation not on record | 1 |
| PUC-RSlocation not on record | 1 |
| H-Dueringlocation not on record | 1 |
| Fullerton, US | 1 |
| Arequipa, PE | 1 |
| Philadelphia, US | 1 |
| Sendai, JP | 1 |
| Universidade Federale do Rio Grande do Sullocation not on record | 1 |
| UNESP-FCAlocation not on record | 1 |
| La Paz, BO | 1 |
| Jiangxi College of Educationlocation not on record | 1 |
| Porvoo, FI | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| BAYLUlocation not on record | 1 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 1 |
| Sevilla, ES | 1 |
| Macomb, US | 1 |
| The University of Arizonalocation not on record | 1 |
| Memorial University of Newfoundlandlocation not on record | 1 |
| Bothell, US | 1 |
| Henderson State Universitylocation not on record | 1 |
| Namur, BE | 1 |
| Austin, US | 1 |
| Fukushima Universitylocation not on record | 1 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 1 |
| Ypsilanti, US | 1 |
| JBSlocation not on record | 1 |
| Beijing, CN | 1 |
| Conway, US | 1 |
| State University of New York, College at Oneontalocation not on record | 1 |
| Research Center in Biodiversity and Genetic Resourceslocation not on record | 1 |
| Naturalis Biodiversity Centerlocation not on record | 1 |
| CJBNlocation not on record | 1 |
| HJAEFlocation not on record | 1 |
| OLAlocation not on record | 1 |
| Pondicherry, IN | 1 |
| Podgorica, ME | 1 |
| Henderson, US | 1 |
| Bratislava, SK | 1 |
| Regensburgische Botanische Gesellschaftlocation not on record | 1 |
| Hamilton, US | 1 |
| University of Bayreuthlocation not on record | 1 |
| Dover, US | 1 |
| San Diego Natural History Museumlocation not on record | 1 |
| Mexico City, MX | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| Stockholm, SE | 1 |
| Banyoles, ES | 1 |
| Salvador, BR | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Fort Bragg, US | 1 |
| San Bernardino, US | 1 |
| Norfolk, US | 1 |
| Fairfax, US | 1 |
| Sagamihara, JP | 1 |
| Ashland, US | 1 |
| Hazara Universitylocation not on record | 1 |
| Nantes Culture Collectionlocation not on record | 1 |
| ESP109location not on record | 1 |
| Fujian Institute of Subtropical Botanylocation not on record | 1 |
| Mexico City, MX | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Lausanne, CH | 1 |
| GAlocation not on record | 1 |
| Universidad Nacional de La Pampalocation not on record | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| Rishon Le Zion, IL | 1 |
| Jefferson City, US | 1 |
| Phoenix, US | 1 |
| SEFlocation not on record | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Lincoln, US | 1 |
| Baltimore, US | 1 |
| Johnson City, US | 1 |
| Xiamen, CN | 1 |
| Kensington, AU | 1 |
| Provincia di Livornolocation not on record | 1 |
| Little Rock, US | 1 |
| Durham, US | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Ivano-Frankove, UA | 1 |
| Honolulu, US | 1 |
| University of Tennessee at Chattanoogalocation not on record | 1 |
| China Agricultural Universitylocation not on record | 1 |
| Kingston, US | 1 |
| USFSlocation not on record | 1 |
| Montréal, CA | 1 |
| Truckee, US | 1 |
| Taipei, TW | 1 |
| Smithfield, AU | 1 |
370 institutions · 6 346 of 6 778 vouchered records shown · 428 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA14 detections
Where the DNA of Anthemis cotula was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found14
Studies independent surveys1
Countries7
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 14 detections have coordinates
Open the map7 countries0
Pond/Riparian vegetation with Schoenoplectus…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median16.2 °C 14.5–20.4
Seasonal swing summer↔winter18.7 °C
Max temp (day)20.5 °C 17.7–25.7
Min temp (night)12.2 °C 10.4–16.1
Precipitation70.4 mm/mo 31.8–83.0
Air humidity59.9 % 57.6–62.8
Moisture balance-47.0 mm/mo -133–7.00
Vapour deficit793 Pa 627–1,015
Wind speed3.10 m/s 2.60–4.20
Cloud cover40.9 % 35.0–43.7
CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.