Anthemis chrysantha

Gay · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Anthemis

At a glance

Occurrence records74

Data sources3

Biological traits3

DNA specimens0

eDNA detections0

Sources3 archives

Databases and archives Anthemis chrysantha's data was compiled from.

GBIFGlobal Biodiversity Information Facility74 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements2 literature sources3 traits

Occurrence & distributionGBIF74 records

DNA & barcodingNCBIsequences

02Traits & measurements

SourcesWCVPTRY

Size & morphology1

Seed mass0.306 mg

Life cycle & reproduction1

Life formannual

Habitat & environment1

Climatesubtropical

05DNA & barcoding6 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthemis chrysantha has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences6

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKJ475133.1 ↗202 bpSpain · 2009

ACGT

ATCGCGTCGCCCCCAACAAATTACTGTTGGGGGCGGATATTGGTCTCCCGTGCTCATGGTGTGGTTGTCCAAAATAGGAGTCCCTTCGAT …

Anthemis chrysantha voucher CM13-00780 internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS6

fungal barcode

08Occurrence & distribution

Record type74 records

Wild obs. + sensor27

Museum / vouchered47

Range

Area of Occupancy AOO140 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy52% within 1 km

≤100 m 9≤1 km 3≤10 km 10>10 km 1

23 georeferenced · 4 without coordinates

Open the mapobservation + sensor27

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤1 km 6≤10 km 7>10 km 1

14 georeferenced · 33 without coordinates

Open the institutions mapphysical evidence47

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo della Bonifica di San Donà di Piavelocation not on record	9
BClocation not on record	8
Paris, FR	4
MAlocation not on record	4
Kew, GB	4
Barcelona, ES	3
Salamanca, ES	2
València, ES	2
College of the Atlantic, Museumlocation not on record	2
Madrid, ES	1
Berlin, DE	1
Wlocation not on record	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Córdoba, ES	1
Museo Achille Folettolocation not on record	1

15 institutions · 44 of 47 vouchered records shown · 3 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)