Anthemis arvensis
speciesAt a glance
Occurrence records65 897
Data sources13
Biological traits75
DNA specimens31
eDNA detections15
Sources13 archives
Databases and archives Anthemis arvensis's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility65 897 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics31 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources75 traits
Chemical compositionLOTUS4 compounds
Occurrence & distributionGBIF65 897 records
Environmental DNA1 datasets · 7 countries15 detections
DNA & barcodingBOLD · NCBI31 specimens
Genome at a glanceCCDB · GoaT2n = 18
01Narrative
L'Anthémis des champs est une espèce de plantes herbacées annuelle de la famille des Astéracées. Autres noms communs : Camomille sauvage, fausse camomille.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology24
Fruit length2 mm
Fruit length max2.5 mm
Fruit length min1.8 mm
Leaf length45 mm
Leaf length max30 mm
Leaf length min20 mm
Leaf mass13.01 mg
Leaf size374 mm²
Leaf width15 mm
Leaf width max30 mm
Leaf width min20 mm
Plant height0.278 m
⚠ sources differ — GIFT: 0.278 m · AusTraits: 0.6 m · LEDA: 0.285 m · TRY: 0.645 m
Plant height generative0.27 m
Plant height max0.8 m
Plant height min0.05 m
Seed length2.25 mm
⚠ sources differ — TRY: 2.25 mm · GIFT: 2.5 mm
Seed length max2.5 mm
Seed length min2.5 mm
Seed mass0.64 mg
⚠ sources differ — TRY: 0.64 mg · LEDA: 0.721 mg · GIFT: 0.679 mg
Seed mass max0.72 mg
Seed mass min0.61 mg
Seed volume0.56 mm³
Seed volume max0.56 mm³
Seed volume min0.56 mm³
Life cycle & reproduction22
Deciduousnessevergreen
Dehiscenceindehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: endozoochor · GIFT: unspecialized
Flower colourwhite
Flower length max12 mm
Flower length min6 mm
Flower width max35 mm
Flower width min20 mm
Flowering endSep
Flowering startJun
Flowering timeynnnnnnnnnny
Life formannual or biennial
Life spanannual
⚠ sources differ — TRY: summer annuals · AusTraits: annual biennial · LEDA: summer annuals · GIFT: annual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproduction asexualabsent
Resprouting capacityfire_killed
Seed number3 075
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment15
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max1 500 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typeachene
Growth formherb
Habitat GIFTcrop fields, meadows: dry, old fields
Leaf compoundnesssimple
Leaf formlinear
Leaf shapefiliform linear
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry8
Leaf C:N ratio33.45 g/g
Leaf c461 mg/g
Leaf dry-matter content (LDMC)144 mg/g
Leaf n13.27 mg/g
Leaf p2.13 mg/g
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)26.92 mm²/mg
⚠ sources differ — TRY: 26.92 mm²/mg · LEDA: 31.88 mm²/mg · GIFT: 31.88 mm²/mg
Other traits4
Diaspore typefruit
Leaf arrangementalternate
Seeds per fruit>1000
Shoot orientationascending
03Chemical composition4 compounds
Compounds documented for Anthemis arvensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile1 class
Secogermacrane sesquiterpenoids4
Documented compounds4 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (4R)-3-methylidene-4-[(E)-3-methyl-4-[(2R,4S)-4-methyl-5-oxooxolan-2-yl]but-2-enyl]oxolan-2-one | present | LOTUS | |
| (5R)-3-methylidene-5-[(2R)-2-methyl-4-[(3R)-4-methylidene-5-oxooxolan-3-yl]-3-oxobutyl]oxolan-2-one | present | LOTUS | |
| 3-Methylidene-4-[3-methyl-4-(4-methyl-5-oxooxolan-2-yl)but-2-enyl]oxolan-2-one | present | LOTUS | |
| 3-Methylidene-5-[2-methyl-4-(4-methylidene-5-oxooxolan-3-yl)-3-oxobutyl]oxolan-2-one | present | LOTUS |
05DNA & barcoding31 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthemis arvensis has left across the world's sequence archives.
At a glance
DNA specimens31
Marker genes7
GenBank sequences10
eDNA detections15
Countries9
The DNA barcodea real sequence read deposited for this species
AATCGCGTCGCCCCCAACAAATCTATGTTGGGGCGATATTGGTCTCCCGTGCTCATGGTGTGGTTGGCCAAAATAGGAGTCCCTTCGATG …
Anthemis arvensis internal transcribed spacer 2, complete sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL3★rbcLa★trnL-F★ITS5★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Anthemis arvensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidydiploid inferred
Chromosome records18–182n range18median18mode54records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1854×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · ita-fl · CCDB · slov-fl +13
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · ita-fl — PAVONE P., TERRASI M.C., ZIZZA A. - 1981. Chromosome number reports LXXII.. Taxon , 30(3): 695-696.
CCDB · ita-fl — MARTINOLI G. - 1942. Contributo all'embriologia delle Asteraceae:VI.. N. Giorn. Bot. Ital., n.s. , 49(3-4): 311-336.
CCDB · ita-fl — BRULLO S., PAVONE P., ZIZZA A. - 1978. Numeri cromosomici per la flora italiana:506-516.. Inform. Bot. Ital. , 10(3): 397-405.
CCDB · ita-fl — BRULLO S., MAJORANA G., PAVONE P., ZIZZA A. - 1978. Numeri cromosomici per la flora italiana:375-381.. Inform. Bot. Ital. , 10(1): 57-63.
CCDB · slov-fl — Váchová M. & Feráková V., 1980: [Report], pp. 722-723. - In: Löve Á. (ed.), Chromosome numbers reports LXIX, Taxon 29 /5-6.
CCDB · slov-fl — Váchová M. & Feráková V., 1978: [Report], pp. 382-383. - In: Löve Á. (ed.), IOPB Chromosome number reports LXI, Taxon 27 /4.
CCDB · slov-fl — Feráková V., 1983: Kariotaksonomicheskie primechaniya k izbrannym vidam vysshikh rastenii Bratislavy i ee okrestnostei, pp. 135-138. - In: Anonymus (ed.), Ekologicheskaya kooperatsiya. Informatsionnyi byulleten´ po probleme III "Okhrana ekosistem (biogeotsenozov) i landshafta". Prilozhenie No 2. Koordinatsionnyi tsentr stran-chlenov SEV i SFRYU & Institut eksperimental´noi biologii i ekologii SAN, Bratislava.
CCDB · brit-fl — Kay, Q.O.N. J. Ecol. 59: 637-648 (1971)
CCDB · iber-fl — Studies on the flora of the Balearic Islands, I. Dahlgren, R., Th. Karlsson & P. Lassen.Bot. Not.124: 249-269(1971).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 245: 5-121(1971).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4057
CCDB · fl-europaea — Rodriguez, 195 3
CCDB · ipcn-api-dl — Dmitrieva, S. A. & V. I. Parfenov. 1983. Khromosomnye chisla nekotorykh vidov flory Belorussii. Izv. Akad. Nauk Belorussk. SSR, Ser. Biol. Nauk 2: 7–12.
CCDB · ipcn-api-dl — Stephanov, G. 1982. In IOPB chromosome number reports LXXVII. Taxon 31: 764.
CCDB · ipcn-api-dl — Hill, L. M. 1989. IOPB chromosome data 1. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 13: 17–19.
CCDB · ipcn-api-dl — Jasiewicz, A. & M. Mizianty. 1975. Chromosome numbers of some Bulgarian plants. Fragm. Florist. Geobot. 21: 277–288.
CCDB · ipcn-api-dl — Pavone, P., C. M. Terrasi & A. Zizza. 1981. In Chromosome number reports LXXII. Taxon 30: 695–696.
CCDB · ipcn-api-dl — Vachova, M. & V. Ferakova. 1980. In Chromosome number reports LXIX. Taxon 29: 722–723.
CCDB · ipcn-api-dl — Kuzmanov, B., N. Thin & S. Georgieva. 1981. A cytotaxonomic study on Bulgarian Anthemis species. Candollea 36: 19–76.
CCDB · ipcn-api-dl — Vachova, M. 1978. In Index of chromosome numbers of Slovakian flora. Part 6. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 26: 1–42.
CCDB · ipcn-api-dl — Humphries, C. J., B. G. Murray, G. Bocquet & K. N. Vasudevan. 1978. Chromosome numbers of phanerogams from Morocco and Algeria. Bot. Not. 131: 391–404.
CCDB · ipcn-api-dl — Oberprieler, C. 1998. The systematics of Anthemis L. (Compositae, Anthemideae) in W and C North Africa. Bocconea 9: 1–328.
CCDB · ipcn-api-dl — Kuzmanov, B., N. Thin & S. Georgieva. 1980. In Chromosome number reports LXIV. Taxon 29: 714–715.
CCDB · ipcn-api-dl — Brullo, S., G. MAJORANA, P. Pavone & M. C. Terrasi. 1978. Numeri cromosomici per la Flora Italiana. Inform. Bot. Ital. 10: 46 and 80.
CCDB · book-ipcn67-71 — FERNANDES, A., & M. QUEIROS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. II Compositae Bol. soc. Brot. 45 (ser. 2l: 5-122.
CCDB · book-northern-plants — Wulff 1937 b. Harling (unpubl.).
CCDB · book-ipcn73-74 — DAHLGREN, R., TH. KARLSSON, & P. LASSEN. 1971. Studies on the flora I < the Balearic Islands. I. Chromosome numbers in Balearic angiosperms. sot. Notiser 124: 249~269.
CCDB · eflora
CCDB · book-fedorov — Wulff 1937b
CCDB · book-fedorov — Martinoli 1942
CCDB · book-fedorov — L. 1961)
CCDB · book-fedorov — Harling (LOve A., Love D. 1948), 1950
CCDB · book-fedorov — LOve A., LOve D. 1956b
CCDB · book-atlas-flowering-plants — Eur., N. Afr.,
CCDB · Cave1956 — Love & Love b
CCDB · CromoCat 2015 — Dahlgren, R., Karlsson, Th. & Lassen, P. (1971). Studies on the Flora of the Balearic Islands, I. Chromosome numbers in Balearic Angiosperms. Bot. Not. 124(1): 249-269.
CCDB · CromoCat 2015 — Hill, L. M. (1989). IOPB Chromosome Data 1 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 13: 17-19.
CCDB · CromoCat 2015 — Jasiewicz, A. & Mizianty, M. (1975). Chromosome numbers of some Bulgarian plants. Fragm. Florist. Geobot. 12: 277-288.
CCDB · CromoCat 2015 — Kuzmanov, B., Thin, N. N. & Georgieva, S. (1981d). A cytotaxonomic study on Bulgarian Anthemis species. Candollea 36: 19-76.
+12 more references
2n 02×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Keil, D. J. & Pinkava, D. J. (1977). Reinstatement of Carminatia DC. (Compositae: Eupatorieae). Phytologia 35: 323.
CCDB · CromoCat 2015 — Oberprieler, C. (1998). The systematics of Anthemis L. (Compositae, Anthemideae) in W and C North Africa. Bocconea 9: 1–328.
2n 272×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl
CCDB · CromoCat 2015 — Kuzmanov, B., Thin, N. N. & Georgieva, S. (1980). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIX]. Taxon 29(5): 714-715.
n 99×CCDB · ita-fl · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ita-fl — MARTINOLI G. - 1942. Contributo all'embriologia delle Asteraceae:VI.. N. Giorn. Bot. Ital., n.s. , 49(3-4): 311-336.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Keil, D. J. & D. J. PINKAVA. 1977. Reinstatement of Carminatia DC. (Compositae: Eupatorieae). Phytologia 35: 323.
CCDB · ipcn-api-dl — Oberprieler, C. 1998. The systematics of Anthemis L. (Compositae, Anthemideae) in W and C North Africa. Bocconea 9: 1–328.
CCDB · CromoCat 2015 — Arohonka, T. (1982). Kromosomilukumäärityksiä Nauvon Seilin saaren putkilokasveista. (Chromosome counts of vascular plants of the island Seiliin Nauvo, SW Finland) Turun Yliopiston Biologian Laitoksen Julkaisuja 3: 1-12.
CCDB · CromoCat 2015 — Harling, G. (1950). Embryological studies in the Compositae. Part. I. Anthemidae-Anthemidinae. Acta Horti Berg. 15: 135-168.
CCDB · CromoCat 2015 — Keil, D. J. & Pinkava, D. J. (1977). Reinstatement of Carminatia DC. (Compositae: Eupatorieae). Phytologia 35: 323.
CCDB · CromoCat 2015 — Oberprieler, C. (1998). The systematics of Anthemis L. (Compositae, Anthemideae) in W and C North Africa. Bocconea 9: 1–328.
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Oberprieler, C. (1998). The systematics of Anthemis L. (Compositae, Anthemideae) in W and C North Africa. Bocconea 9: 1–328.
n 81×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Blanché C., C. B. & J. Vall;ages-Xirau. 1985. Chromosome Number Reports LXXXVII. Taxon 34: 346–351.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type65 897 records
Wild obs. + sensor53 344
Museum / vouchered12 096
Cultivated / captive37
Other420
Origin
Native648
Introduced1 302
Range
Area of Occupancy AOO138 640 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy45% within 1 km
≤100 m 12 843≤1 km 8 254≤10 km 24 966>10 km 340
46 403 georeferenced · 6 941 without coordinates
Open the mapobservation + sensor53 344
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy39% within 1 km
≤100 m 477≤1 km 2 971≤10 km 5 066>10 km 236
8 750 georeferenced · 3 346 without coordinates
Open the institutions mapphysical evidence12 096
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1>10 km 13
14 georeferenced · 23 without coordinates
Open the mapnot free-living37
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions140 of 248 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 5 209 |
| Berlin, DE | 444 |
| Paris, FR | 397 |
| LDlocation not on record | 342 |
| Olocation not on record | 283 |
| Philadelphia, US | 242 |
| BRNUlocation not on record | 232 |
| IFR-DNFlocation not on record | 178 |
| Adam Mickiewicz University in Poznańlocation not on record | 160 |
| MeiseBGlocation not on record | 148 |
| Oskarshamn, SE | 138 |
| Uppsala, SE | 131 |
| Salzburg, AT | 128 |
| Uniwersytet Warszawskilocation not on record | 107 |
| CICYTEXlocation not on record | 101 |
| SLU Artdatabankenlocation not on record | 93 |
| Turku, FI | 90 |
| Kuopio, FI | 86 |
| Oulu, FI | 79 |
| Bergen, NO | 76 |
| Tartu, EE | 76 |
| Moscow State Universitylocation not on record | 75 |
| MAlocation not on record | 72 |
| Lausanne, CH | 66 |
| Zürich, CH | 65 |
| Entomological Society of Latvialocation not on record | 63 |
| BDBClocation not on record | 62 |
| Trondheim, NO | 61 |
| BFLlocation not on record | 59 |
| Provincia di Livornolocation not on record | 59 |
| Görlitz, DE | 53 |
| KMNlocation not on record | 49 |
| College of the Atlantic, Museumlocation not on record | 47 |
| BClocation not on record | 46 |
| Allentown, US | 46 |
| Chongqing Museumlocation not on record | 45 |
| College Park, US | 44 |
| Vitoria, ES | 43 |
| Salamanca, ES | 41 |
| Barcelona, ES | 40 |
| València, ES | 39 |
| Williamsburg, US | 39 |
| Badajoz, ES | 38 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 36 |
| University of Stellenboschlocation not on record | 32 |
| Wlocation not on record | 32 |
| San Sebastián, ES | 32 |
| Bern, CH | 30 |
| Jaén, ES | 30 |
| South Kensington, GB | 30 |
| Jyväskylä, FI | 29 |
| Granada, ES | 29 |
| Córdoba, ES | 29 |
| UChlocation not on record | 29 |
| Bronx, US | 28 |
| Tallinn, EE | 28 |
| Ann Arbor, US | 25 |
| Chapel Hill, US | 24 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 23 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 23 |
| DBF-NHMDlocation not on record | 20 |
| Helsinki, FI | 19 |
| Zürich, CH | 19 |
| BIO-UNIPIlocation not on record | 19 |
| CJBGlocation not on record | 19 |
| Mlocation not on record | 19 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 19 |
| Corvallis, US | 18 |
| New Haven, US | 18 |
| Pullman, US | 17 |
| Madrid, ES | 16 |
| Alicante, ES | 16 |
| Burlington, US | 15 |
| UGentlocation not on record | 15 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 14 |
| Brussel, BE | 14 |
| PRClocation not on record | 14 |
| LfUlocation not on record | 13 |
| WTUlocation not on record | 13 |
| Palacký University in Olomouclocation not on record | 12 |
| Fulda, DE | 12 |
| GJOlocation not on record | 12 |
| Porvoo, FI | 12 |
| New Brunswick, US | 12 |
| Saint Louis, US | 11 |
| Dresden, DE | 11 |
| Canberra, AU | 11 |
| Phyletisches Museum Jenalocation not on record | 11 |
| Uniwersytet Śląski w Katowicachlocation not on record | 10 |
| Frankfurt am Main | 10 |
| Bangkok, TH | 10 |
| Mount Annan, AU | 10 |
| Nijmegen, NL | 9 |
| Moscow, US | 9 |
| Wuzhou, CN | 9 |
| Garðabær, IS | 9 |
| TUR-Alocation not on record | 9 |
| TROMlocation not on record | 9 |
| EEZA-CSIClocation not on record | 9 |
| Norfolk, US | 8 |
| Natural History Museum Rotterdamlocation not on record | 8 |
| Gijón, ES | 8 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 7 |
| Canadian Department of Agriculturelocation not on record | 7 |
| Washington, US | 7 |
| Museo Entomologico de Leonlocation not on record | 7 |
| Hobart, AU | 7 |
| GZUlocation not on record | 7 |
| Bloomington, US | 7 |
| Museo Achille Folettolocation not on record | 7 |
| Lord Fairfax Community Collegelocation not on record | 7 |
| Frauenfeld, CH | 7 |
| Odawara, JP | 7 |
| Christchurch, NZ | 7 |
| Bourges, FR | 6 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 6 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 6 |
| UIBlocation not on record | 6 |
| Staten Island, US | 6 |
| Tsukuba, JP | 6 |
| Toronto, CA | 5 |
| Forssa, FI | 5 |
| UniKSlocation not on record | 5 |
| McWane Science Centerlocation not on record | 5 |
| Fairfax, US | 5 |
| NMBU:MINAlocation not on record | 5 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 5 |
| BSBIlocation not on record | 5 |
| Valparaiso, CL | 5 |
| Kew, GB | 5 |
| Philadelphia, US | 4 |
| Monastir, TN | 4 |
| Knoxville, US | 4 |
| KURAlocation not on record | 4 |
| Sanda, JP | 4 |
| Stockholm, SE | 4 |
| Vancouver, CA | 4 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 4 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 4 |
| Glarus, CH | 4 |
| John May Museum of Natural Historylocation not on record | 3 |
| Porrentruy, CH | 3 |
| Namur, BE | 3 |
| Auckland, NZ | 3 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 3 |
| FLADlocation not on record | 3 |
| Adelaide, AU | 3 |
| Millersville, US | 3 |
| GAlocation not on record | 3 |
| Uniwersytet Opolskilocation not on record | 3 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 3 |
| Montréal, CA | 3 |
| University of Alberta Museumslocation not on record | 3 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 3 |
| SZUlocation not on record | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| nbflocation not on record | 3 |
| JBSlocation not on record | 3 |
| Pretoria, ZA | 3 |
| Sevilla, ES | 2 |
| Clemson, US | 2 |
| Winterthur, CH | 2 |
| Portland, US | 2 |
| Wellington, NZ | 2 |
| BGBMlocation not on record | 2 |
| HUN003location not on record | 2 |
| Asheville, US | 2 |
| Dekalb, US | 2 |
| Xiamen, CN | 2 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 2 |
| Ashland, US | 2 |
| 2 | |
| Armidale, AU | 2 |
| Tacoma, US | 2 |
| Shinshu Universitylocation not on record | 2 |
| NoColllocation not on record | 2 |
| Davenport, US | 2 |
| ESP109location not on record | 2 |
| Pacific Lutheran Universitylocation not on record | 2 |
| San Diego, US | 2 |
| University of New Hampshirelocation not on record | 2 |
| National Institute of Biological Resourceslocation not on record | 2 |
| Chiba, JP | 2 |
| Victoria, CA | 2 |
| H-AkrKGlocation not on record | 2 |
| Université Lavallocation not on record | 2 |
| Logan, US | 2 |
| Tilburg, NL | 2 |
| Pamplona, ES | 2 |
| Pittsburg, US | 2 |
| DOI/NPS, Greenbelt Parklocation not on record | 2 |
| Columbia, US | 2 |
| Boumlocation not on record | 1 |
| Palmerston North, NZ | 1 |
| Nantes Culture Collectionlocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| INTAlocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Rovaniemi, FI | 1 |
| Beijing, CN | 1 |
| Saint John, CA | 1 |
| Tromso University Museumlocation not on record | 1 |
| H-Meierottlocation not on record | 1 |
| Chadron, US | 1 |
| IPE-CSIClocation not on record | 1 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 1 |
| Hazara Universitylocation not on record | 1 |
| Tokushima, JP | 1 |
| Universidad del Quindío (UniQuindío)location not on record | 1 |
| University of Tennessee at Chattanoogalocation not on record | 1 |
| Coimbra, PT | 1 |
| Northridge, US | 1 |
| Fribourg, CH | 1 |
| Podgorica, ME | 1 |
| Mississippi State, US | 1 |
| Tuscaloosa, US | 1 |
| UoB-IBlocation not on record | 1 |
| GB | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| JBRJlocation not on record | 1 |
| Göteborg, SE | 1 |
| Bend, US | 1 |
| Little Rock, US | 1 |
| Durban, ZA | 1 |
| Baltimore, US | 1 |
| Porto Alegre, BR | 1 |
| San Luis Obispo, US | 1 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 1 |
| Sion, CH | 1 |
| Boise, US | 1 |
| Minia, EG | 1 |
| Caldwell, US | 1 |
| Naturalis Biodiversity Centerlocation not on record | 1 |
| Provo, US | 1 |
| University of Southern Mississippilocation not on record | 1 |
| OLAlocation not on record | 1 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 1 |
| Rotorua, NZ | 1 |
| Parthenon Tama History Museumlocation not on record | 1 |
| Brisbane, AU | 1 |
| Miami, US | 1 |
| Walla Walla, US | 1 |
| Missoula, US | 1 |
| Western Carolina Universitylocation not on record | 1 |
| Elikins, US | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| Davis, US | 1 |
| Kingston, US | 1 |
248 institutions · 11 318 of 12 096 vouchered records shown · 514 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA15 detections
Where the DNA of Anthemis arvensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found15
Studies independent surveys1
Countries7
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 15 detections have coordinates
Open the map7 countries0
riparian with Salix lasiolepis and S. laevig…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.3 °C 12.9–17.4
Seasonal swing summer↔winter18.2 °C
Max temp (day)20.2 °C 15.9–21.5
Min temp (night)9.90 °C 8.90–13.2
Precipitation72.7 mm/mo 36.8–108
Air humidity58.0 % 53.2–61.5
Moisture balance-29.8 mm/mo -68.3–-11.9
Vapour deficit778 Pa 547–938
Wind speed2.90 m/s 2.30–4.20
Cloud cover41.0 % 37.6–44.3
CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.