Anthelia glauca

Lamarck, 1816 · species

image placeholder — illustration coming later

Animalia/Cnidaria/Anthozoa/Malacalcyonacea/Xeniidae/Anthelia

At a glance

Occurrence records178

Data sources9

Biological traits2

DNA specimens11

eDNA detections2

Sources9 archives

Databases and archives Anthelia glauca's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility138 records↗

OBISOcean Biodiversity Information System40 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Chemical compositionLOTUS · NPASS67 compounds

Occurrence & distributionGBIF · OBIS178 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD11 specimens

01Narrative

Anthelia glauca Lamarck, 1816 è un ottocorallo della famiglia Xeniidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

03Chemical composition67 compounds

Compounds documented for Anthelia glauca across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Germacrane sesquiterpenoids30

Eudesmane sesquiterpenoids11

Xenicane diterpenoids3

Acyclic monoterpenoids2

Cholestane steroids $ Ergostane steroids2

Documented compounds67 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,2S,4R,5S,7E,11S)-5-hydroxy-4,8-dimethyl-12-methylidene-3,14-dioxatricyclo[9.3.0.02,4]tetradec-7-en-13-one	present	NPASS
(1S,3R,5R,8E,10R,11S)-10-hydroxy-3,8-dimethyl-12-methylidene-4,14-dioxatricyclo[9.3.0.03,5]tetradec-8-en-13-one	present	NPASS
(1S,3R,5S,8E,10R,11S)-10-hydroxy-3,8-dimethyl-12-methylidene-4,14-dioxatricyclo[9.3.0.03,5]tetradec-8-en-13-one	present	NPASS
(2R,4aR,8aR)-1,2,3,4,4a,5,6,8a-Octahydro-4a,8-dimethyl-alpha-methylene-2-naphthaleneacetic acid	present	NPASS
(2R,5S)-5-hydroperoxy-6-methyl-2-[(1R)-4-methylcyclohex-3-en-1-yl]hept-6-en-2-ol	present	NPASS
(3aS,4R,5E,9E,11aS)-3a,4,7,8,11,11a-Hexahydro-4-hydroxy-6,10-dimethyl-3-methylenecyclodeca(b)furan-2(3H)-one	present	NPASS
(3aS,4R,5E,9R,11aS)-3a,4,7,8,9,10,11,11a-Octahydro-4,9-dihydroxy-6-methyl-3,10-bis(methylene)cyclodeca(b)furan-2(3H)-one	present	NPASS
(3aS,4R,5E,9R,11aS)-9-hydroperoxy-4-hydroxy-6-methyl-3,10-dimethylidene-4,7,8,9,11,11a-hexahydro-3aH-cyclodeca[b]furan-2-one	present	NPASS
(3aS,4R,5E,9S,10E,11aS)-9-hydroperoxy-4-hydroxy-6,10-dimethyl-3-methylidene-3a,4,7,8,9,11a-hexahydrocyclodeca[b]furan-2-one	present	NPASS
(3aS,4R,5E,9S,11aS)-9-hydroperoxy-4-hydroxy-6-methyl-3,10-dimethylidene-4,7,8,9,11,11a-hexahydro-3aH-cyclodeca[b]furan-2-one	present	NPASS

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthelia glauca has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections2

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P659 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

156Tmostly conserved

567Tvariable

ATGAACAAATTTATTACACGTTGGCTATTTTCCACTAATCATAAGGATATAGGTACTTTATATTTATTATTTGGTGCTTTTTCTGGGATG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.15%

Haplotypes3

BIN1

Most divergent pair0.30%

OtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthelia philippinensesame genus1.7%Sympodium arbusculumsame family3.9%Sympodium caeruleumsame family3.9%Conglomeratusclera coeruleasame family3.9%Sansibia flavasame family4.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_061996 ↗ · 14 protein · 1 tRNA · 2 rRNA

ND2ND5ND4COX3CYTBND1COX1COX2ATP8ATP6ND6ND3ND4LmutSrnlrns

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type178 records

Wild obs. + sensor116

Museum / vouchered59

Other3

Range

Area of Occupancy AOO284 km²

Depth

0–200 m sunlit18

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 20 m · max 31 m · 18 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 12≤1 km 7≤10 km 2>10 km 4

25 georeferenced · 91 without coordinates

Open the mapobservation + sensor116

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy95% within 1 km

≤100 m 21≤10 km 1

22 georeferenced · 37 without coordinates

Open the institutions mapphysical evidence59

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natick, US	9
Frankfurt am Main	7
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	6
CASlocation not on record	4
Museum and Art Gallery of the Northern Territorylocation not on record	3
Queensland Museumlocation not on record	3
Sydney, AU	1

7 institutions · 33 of 59 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Anthelia glauca was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)