Anthela excellens

(Walker, 1855) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Anthelidae/Anthela

At a glance

Occurrence records339

Data sources7

Biological traits0

DNA specimens16

eDNA detections16

Sources7 archives

Databases and archives Anthela excellens's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility339 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF339 records

Environmental DNA1 datasets · 1 countries16 detections

DNA & barcodingBOLD16 specimens

01Narrative

Anthela excellens is a moth of the Anthelidae family. It is found in Australia.Australian Faunal Directory

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthela excellens has left across the world's sequence archives.

At a glance

DNA specimens16

BINs4

Marker genes1

eDNA detections16

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 73 variable positions, in barcode order

5Tvariable

13Tmostly conserved

16Tvariable

22Avariable

31Tvariable

38Gmostly conserved

43Tvariable

58Amostly conserved

83Avariable

85Tmostly conserved

100Avariable

101Gmostly conserved

106Tmostly conserved

127Tmostly conserved

139Tvariable

166Amostly conserved

184Tmostly conserved

187Tmostly conserved

197Tvariable

202Tmostly conserved

208Avariable

212Tmostly conserved

220Cvariable

235Cmostly conserved

238Avariable

241Amostly conserved

259Tvariable

262Gmostly conserved

263Tvariable

266Tmostly conserved

268Gvariable

274Tmostly conserved

277Tmostly conserved

286Tvariable

319Tmostly conserved

322Amostly conserved

331Amostly conserved

346Cvariable

361Cvariable

364Avariable

367Tmostly conserved

391Cvariable

394Cmostly conserved

397Tvariable

412Avariable

415Amostly conserved

416Gmostly conserved

417Cvariable

424Cvariable

433Amostly conserved

448Tmostly conserved

451Cmostly conserved

469Amostly conserved

508Tmostly conserved

514Avariable

517Amostly conserved

523Tvariable

542Tmostly conserved

548Tmostly conserved

554Avariable

562Avariable

571Tvariable

578Tmostly conserved

581Tvariable

583Amostly conserved

586Avariable

604Tmostly conserved

616Tvariable

619Tmostly conserved

622Amostly conserved

625Amostly conserved

646Cmostly conserved

652Tmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCTGGAATAGTTGGTACATCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAATACTAATTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.8%

Haplotypes10

BINs4

Most divergent pair5.8%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthela stygianasame genus5.5%Anthela ochropterasame genus6.1%Anthela xantharchasame genus6.1%Anthela asciscenssame genus6.1%Anthela euryphricasame genus6.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type339 records

Wild obs. + sensor286

Museum / vouchered53

Range

Area of Occupancy AOO384 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 75≤1 km 169≤10 km 10>10 km 4

258 georeferenced · 28 without coordinates

Open the mapobservation + sensor286

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 1≤10 km 2

3 georeferenced · 50 without coordinates

Open the institutions mapphysical evidence53

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museums Victorialocation not on record	34
Australian National Fish Collectionlocation not on record	6
New Haven, US	2
Sydney, AU	1
DPIlocation not on record	1

5 institutions · 44 of 53 vouchered records shown · 9 without an institution code

09Environmental DNA16 detections

Where the DNA of Anthela excellens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.2 °C 20.1–24.1

Seasonal swing summer↔winter11.6 °C

Max temp (day)26.6 °C 24.5–29.4

Min temp (night)18.5 °C 16.0–19.4

Precipitation112 mm/mo 77.8–145

Air humidity61.6 % 56.3–63.6

Moisture balance-16.5 mm/mo -105–20.6

Vapour deficit986 Pa 843–1,291

Wind speed2.80 m/s 1.80–3.80

Cloud cover30.8 % 24.7–34.0

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)