Anthanassa hermas

(Hewitson, 1864) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nymphalidae/Anthanassa

At a glance

Occurrence records600

Data sources6

Biological traits0

DNA specimens14

eDNA detections17

Sources6 archives

Databases and archives Anthanassa hermas's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility600 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF600 records

Environmental DNA1 datasets · 1 countries17 detections

DNA & barcodingBOLD14 specimens

01Narrative

Anthanassa hermas is een vlinder uit de familie Nymphalidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1864 door William Chapman Hewitson.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthanassa hermas has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes1

eDNA detections17

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

268Cmostly conserved

355Tmostly conserved

364Cmostly conserved

496Amostly conserved

574Tmostly conserved

TACCTTATATTTTATTTTTGGAATTTGAGCAGGTATAGTGGGAACTTCTTTAAGACTTTTAATTCGAACAGAATTAGGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.24%

Haplotypes4

BIN1

Most divergent pair0.76%

S.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthanassa tulcissame genus3.3%Anthanassa frisiasame genus3.3%Castilia myiasame family5.8%Phyciodes batesiisame family6.2%Anthanassa crithonasame genus6.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type600 records

Wild obs. + sensor596

Museum / vouchered4

Range

Area of Occupancy AOO1 372 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 272≤1 km 161≤10 km 44>10 km 17

494 georeferenced · 102 without coordinates

Open the mapobservation + sensor596

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
UNICAMPlocation not on record	2
MZLUlocation not on record	1
Universidad Nacional de Colombia (UNAL)location not on record	1

3 institutions · 4 of 4 vouchered records shown

09Environmental DNA17 detections

Where the DNA of Anthanassa hermas was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.4 °C 16.5–26.0

Seasonal swing summer↔winter11.2 °C

Max temp (day)23.6 °C 20.4–30.6

Min temp (night)15.9 °C 12.9–21.6

Precipitation103 mm/mo 53.0–153

Air humidity61.4 % 58.0–63.2

Moisture balance-2.20 mm/mo -54.3–15.7

Vapour deficit859 Pa 690–1,412

Wind speed3.60 m/s 2.60–3.90

Cloud cover33.0 % 29.7–41.1

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)