Antennarius commerson

(Lacepède, 1798) · species

image placeholder — illustration coming later

Animalia/Chordata/Lophiiformes/Antennariidae/Antennarius

At a glance

Occurrence records1 420

Data sources9

Biological traits0

DNA specimens5

eDNA detections4

Sources9 archives

Databases and archives Antennarius commerson's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 276 records↗

OBISOcean Biodiversity Information System144 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF · OBIS1 420 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD5 specimens

01Narrative

The Commerson's frogfish changes its colour through a range of hues, and uses its pelvic fins to walk on the bottom and keep a stable position for ambush Commerson's frogfish or the giant frogfish, Antennarius commerson, is a marine fish belonging to the family Antennariidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antennarius commerson has left across the world's sequence archives.

At a glance

DNA specimens5

BINs2

Marker genes1

eDNA detections4

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 85% of positions are identical in every specimen.

Where individuals differ — all 99 variable positions, in barcode order

4Gmostly conserved

16Tmostly conserved

28Cmostly conserved

37Amostly conserved

40Amostly conserved

46Tmostly conserved

49Cmostly conserved

53Cmostly conserved

55Gmostly conserved

56Cmostly conserved

64Gmostly conserved

76Tmostly conserved

82Amostly conserved

91Amostly conserved

92Cmostly conserved

97Tvariable

106Amostly conserved

118Amostly conserved

136Tmostly conserved

142Cmostly conserved

145Amostly conserved

151Cmostly conserved

160Tmostly conserved

166Tmostly conserved

169Cmostly conserved

172Gmostly conserved

178Amostly conserved

190Tmostly conserved

196Amostly conserved

202Amostly conserved

203Cmostly conserved

214Cmostly conserved

217Tmostly conserved

220Amostly conserved

226Gmostly conserved

235Amostly conserved

238Amostly conserved

262Cmostly conserved

274Cmostly conserved

277Cmostly conserved

283Tmostly conserved

287Tmostly conserved

289Amostly conserved

292Amostly conserved

295Tmostly conserved

299Amostly conserved

300Tmostly conserved

310Cmostly conserved

313Gmostly conserved

316Amostly conserved

319Amostly conserved

334Gmostly conserved

337Cmostly conserved

340Cmostly conserved

349Tmostly conserved

350Gmostly conserved

367Amostly conserved

370Gmostly conserved

376Amostly conserved

394Cmostly conserved

400Cmostly conserved

403Tmostly conserved

409Amostly conserved

415Tmostly conserved

421Tmostly conserved

424Cmostly conserved

425Cmostly conserved

436Cmostly conserved

445Cvariable

448Cmostly conserved

469Cmostly conserved

471Cmostly conserved

473Gmostly conserved

476Cmostly conserved

484Gmostly conserved

497Tmostly conserved

499Amostly conserved

505Cmostly conserved

511Tmostly conserved

514Avariable

517Amostly conserved

518Gmostly conserved

523Tmostly conserved

532Cmostly conserved

535Tmostly conserved

541Cmostly conserved

550Tmostly conserved

556Tmostly conserved

562Cmostly conserved

568Cmostly conserved

575Tmostly conserved

578Cmostly conserved

580Cmostly conserved

604Tmostly conserved

616Tmostly conserved

617Amostly conserved

619Tvariable

622Amostly conserved

650Tmostly conserved

CCTGTATCTTGTATTTGGAGCATGGGCCGGCATAGTAGGAACAGCTCTCAGCCTGCTAATCCGGGCAGAATTAAGTCAACCAGGCGCACT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)6.2%

Haplotypes4

BINs2

Most divergent pair15.0%

OtherOceaniaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Antennarius striatussame genus12.7%Antennarius hispidussame genus13.3%Antennarius indicussame genus13.7%Histrio histriosame family14.0%Antennarius pauciradiatussame genus14.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 420 records

Wild obs. + sensor1 227

Museum / vouchered172

Other21

Range

Area of Occupancy AOO2 576 km²

Depth

0–200 m sunlit24

200–1000 m twilight1

1–4 km midnight0

>4 km abyssal0

median 42 m · max 360 m · 25 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy56% within 1 km

≤100 m 229≤1 km 383≤10 km 164>10 km 323

1 099 georeferenced · 128 without coordinates

Open the mapobservation + sensor1 227

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy71% within 1 km

≤100 m 22≤1 km 14≤10 km 7>10 km 8

51 georeferenced · 121 without coordinates

Open the institutions mapphysical evidence172

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	14
South African Institute for Aquatic Biodiversitylocation not on record	10
Kagoshima University Museumlocation not on record	10
Washington, US	7
Natick, US	6
	5
CASlocation not on record	4
Australian National Fish Collectionlocation not on record	4
Sydney, AU	4
Cambridge, US	2
FishBaselocation not on record	1
Food Research Institute, Ministry of Agriculture, Forestry and Fisherieslocation not on record	1
Museu Nacional de História Natural e da Ciêncialocation not on record	1
CSIRO, Australian National Fish Collectionlocation not on record	1

14 institutions · 70 of 172 vouchered records shown · 2 without an institution code

09Environmental DNA4 detections

Where the DNA of Antennarius commerson was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.3 °C 26.9–27.7

Seasonal swing summer↔winter3.10 °C

Max temp (day)29.0 °C 28.2–29.8

Min temp (night)25.3 °C 25.0–25.5

Precipitation179 mm/mo 104–253

Air humidity64.2 % 63.1–65.3

Vapour deficit1,298 Pa 1,228–1,368

Cloud cover38.7 % 24.9–52.4

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Antennarius commerson

At a glance

Sources9 archives

At a glance

Record type1 420 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 420 records