Antennaria virginica

Stebbins · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Antennaria

At a glance

Occurrence records130

Data sources7

Biological traits7

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Antennaria virginica's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility130 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF130 records

DNA & barcodingNCBIsequences

Genome at a glanceGoaT · TreeOfSex2n = 28

01Narrative

Antennaria virginica is a North American species of flowering plants in the family Asteraceae known by the common names shalebarren pussytoes. It grows on Devonian shale in the eastern United States. It is found in central Appalachian Mountains of Pennsylvania, Maryland, West Virginia, and Virginia, with a few populations in eastern Ohio.Biota of North America Program 2014 county distribution map Antennaria virginica grows up to 25 cm (10 inches) tall, spreading by horizontal stems that run along the surface of the ground. Male and female flower heads are borne on separate plants. One plant can have several heads in a flat-topped array.Flora of North America Vol. 19, 20 and 21 Page 403 Shalebarren pussytoes Antennaria virginica StebbinsStebbins, George Ledyard 1935. Rhodora 37(439): 229–237 descriptions in Latin and English, discussion in English, line drawings on page 235

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFT

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antennaria virginica has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

ITSL40930.1 ↗216 bp

ACGT

ATCGTGTCGCCCCCTACCACTCCTCTTATAGATGTCTGGTGCGGGGCGGAGATTGGTCTCCCGATTCTCAGATACGGTTGGCCAAAATTG …

Antennaria virginica internal transcribed spacer 2

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Antennaria virginica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidypolyploid inferred

Chromosome records28–282n range28median28mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 282×GoaT · Tree of Sex Database · TreeOfSex · plant

GoaT · Tree of Sex Database — ↗

TreeOfSex · plant — Goldblatt1979 ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

07Deep time~1.4 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin1.4 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type130 records

Wild obs. + sensor21

Museum / vouchered109

Origin

Native1

Range

Area of Occupancy AOO440 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy44% within 1 km

≤100 m 8≤10 km 2>10 km 8

18 georeferenced · 3 without coordinates

Open the mapobservation + sensor21

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 20≤1 km 24≤10 km 51>10 km 2

97 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence109

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chongqing Museumlocation not on record	51
Philadelphia, US	19
Chapel Hill, US	7
Williamsburg, US	7
Lord Fairfax Community Collegelocation not on record	4
Bronx, US	3
Bloomington, US	3
Wuzhou, CN	2
College Park, US	2
University of Stellenboschlocation not on record	2
Morgantown, US	2
Maryland Department of Natural Resourceslocation not on record	1
Lubbock, US	1
Washington, US	1
Philadelphia, US	1
Dover, US	1
Little Rock, US	1
Bangkok, TH	1

18 institutions · 109 of 109 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)