Antennaria monocephala

DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Antennaria

At a glance

Occurrence records620

Data sources13

Biological traits16

DNA specimens26

eDNA detections12

Sources13 archives

Databases and archives Antennaria monocephala's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility620 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

giftgenome & karyotype

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF620 records

Environmental DNA1 datasets · 3 countries12 detections

DNA & barcodingBOLD · NCBI26 specimens

Genome at a glanceCCDB · GoaT · TreeOfSex2n = 28

01Narrative

Antennaria monocephala — вид трав'янистих рослин родини айстрові (Asteraceae), поширений на півночі Північної Америки й на Чукотці. Етимологія: дав.-гр. μονοϛ — «єдино-», дав.-гр. κεφαλη — «голова».

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height min0.1 m

Seed mass0.091 mg

Seed mass max0.09 mg

Seed mass min0.09 mg

Life cycle & reproduction4

Flowering endAug

Flowering startJul

Life formperennial or subshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatesubalpine or subarctic

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTmeadows, tundra

Woodinessnon-woody

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antennaria monocephala has left across the world's sequence archives.

At a glance

DNA specimens26

Marker genes6

GenBank sequences10

eDNA detections12

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMG217593.1 ↗458 bpCanada · 2004

ACGT

GAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAACCATTTGGTTGAGGGCACGTCTGCCTGGGCGTCACG …

Antennaria monocephala voucher CCDB-18322-F1 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL5★rbcLa★ITS2★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · TreeOfSex

The complete instruction manual Antennaria monocephala carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidypolyploid inferred

Chromosome records28–562n range28median28mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 286×GoaT · Tree of Sex Database · CCDB · ipcn-api-dl · CCDB · eflora +1

GoaT · Tree of Sex Database — ↗

CCDB · ipcn-api-dl — Bayer, R. J. & G. L. STEBBINS. 1987. Chromosome numbers, patterns of distribution, and apomixis in Antennaria (Asteraceae: Inuleae). Syst. Bot. 12: 305–319.

CCDB · ipcn-api-dl — Chmielewski, J. G. & C. C. Chinnappa. 1990. The genus Antennaria (Asteraceae: Inuleae) in Arctic North America: chromosome numbers and taxonomic notes. Rhodora 92: 264–276.

CCDB · ipcn-api-dl — Chmielewski, J. G. 2006. Chromosome numbers for western and arctic North American species of Antennaria (Asteraceae: Gnaphalieae). Sida 22(1): 561–563.

CCDB · eflora

TreeOfSex · plant — Goldblatt1979 ↗

2n 561×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — ZHUKOVA, P.G. 1969. Chromosome number in certain plant species indigenous to the north-east of the USSR. IV. Bot. Zurn. 54: 1985-1990.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

polyploid1×GIFT · GIFT (floras)

GIFT · GIFT (floras)

08Occurrence & distribution

Record type620 records

Wild obs. + sensor210

Museum / vouchered410

Range

Area of Occupancy AOO2 016 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy62% within 1 km

≤100 m 85≤1 km 15≤10 km 24>10 km 37

161 georeferenced · 49 without coordinates

Open the mapobservation + sensor210

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy49% within 1 km

≤100 m 28≤1 km 14≤10 km 30>10 km 13

85 georeferenced · 325 without coordinates

Open the institutions mapphysical evidence410

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Victoria, CA	103
University of Alberta Museumslocation not on record	50
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	49
Stockholm, SE	42
WTUlocation not on record	24
Provo, US	22
Missoula, US	16
University of Stellenboschlocation not on record	15
Yukon Universitylocation not on record	15
Anchorage, US	10
Logan, US	7
Chongqing Museumlocation not on record	6
Vancouver, CA	5
Québec, CA	5
St. Paul, US	4
Moscow State Universitylocation not on record	4
Philadelphia, US	4
Research Collection of B. A. Bennettlocation not on record	3
DOI/FWS, Kenai National Wildlife Refugelocation not on record	3
Institute of the biological problems of the North FEB RASlocation not on record	2
Moscow, US	2
Davis, US	1
TROMlocation not on record	1
Beijing, CN	1
Olocation not on record	1
Whitehorse, CA	1
MeiseBGlocation not on record	1
Tromso University Museumlocation not on record	1
Wuzhou, CN	1
Albuquerque, US	1
GB	1
Bozeman, US	1
Millersville, US	1
Bronx, US	1
Trondheim, NO	1

35 institutions · 405 of 410 vouchered records shown · 5 without an institution code

09Environmental DNA12 detections

Where the DNA of Antennaria monocephala was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map3 countries0

Dry river channel in open with Artemisia nor…Dry heath tundra on windswept barrens domina…top of a large boulder close to GAUSP2707

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.80 °C 4.40–14.1

Seasonal swing summer↔winter33.8 °C

Max temp (day)12.8 °C 6.70–18.6

Min temp (night)5.10 °C 2.00–9.10

Precipitation106 mm/mo 52.0–124

Air humidity62.0 % 57.9–65.5

Moisture balance21.6 mm/mo -59.7–54.1

Vapour deficit453 Pa 283–661

Wind speed3.20 m/s 2.10–6.00

Cloud cover52.9 % 44.1–73.6

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)