Antennaria lanata

(Hook.) Greene · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Antennaria

At a glance

Occurrence records1 468

Data sources11

Biological traits17

DNA specimens24

eDNA detections11

Sources11 archives

Databases and archives Antennaria lanata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 468 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Occurrence & distributionGBIF1 468 records

Environmental DNA1 datasets · 3 countries11 detections

DNA & barcodingBOLD · NCBI24 specimens

Genome at a glanceCCDB · GoaT · TreeOfSex2n = 28

01Narrative

Antennaria lanata là một loài thực vật có hoa trong họ Cúc. Loài này được (Hook.) Greene mô tả khoa học đầu tiên năm 1898.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height max0.2 m

Plant height min0.07 m

Seed mass0.018 mg

Seed mass max0.018 mg

Seed mass min0.018 mg

Life cycle & reproduction4

Flowering endJul

Flowering startJun

Life formperennial or subshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatesubalpine or subarctic

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTrivers, sand, sea, shores, stony places, tundra

Woodinessnon-woody

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antennaria lanata has left across the world's sequence archives.

At a glance

DNA specimens24

Marker genes6

GenBank sequences10

eDNA detections11

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMG218419.1 ↗344 bpCanada · 1964

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTTGGTTGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Antennaria lanata voucher 35507HIM 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL3★rbcLa★ITS3★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · TreeOfSex

The complete instruction manual Antennaria lanata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome records28–422n range28median28mode15records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 2813×GoaT · Tree of Sex Database · CCDB · fl-europaea · CCDB · ipcn-api-dl +4

GoaT · Tree of Sex Database — ↗

CCDB · fl-europaea — Urbanska-

CCDB · ipcn-api-dl — Chinnappa, C. C. 1986. Chromosome numbers in Antennaria (Asteraceae: Inuleae) from western North America. Canad. J. Genet. Cytol. 28: 468–475.

CCDB · ipcn-api-dl — Chmielewski, J. G. & C. C. Chinnappa. 1988. The genus Antennaria (Asteraceae: Inuleae) in western North America. II. Additional chromosome counts. Rhodora 90: 133–137.

CCDB · ipcn-api-dl — Chmielewski, J. G. & C. C. Chinnappa. 1990. The genus Antennaria (Asteraceae: Inuleae) in Arctic North America: chromosome numbers and taxonomic notes. Rhodora 92: 264–276.

CCDB · ipcn-api-dl — Urbanska, K. M. 1983. Antennaria carpatica (Wahlb.) Bl. et Fing. s.l. in North America. I. Chromosome numbers, geographical distribution and ecology. Ber. Geobot. Inst. ETH Stiftung Rübel 50: 33–66.

CCDB · ipcn-api-dl — ZHUKOVA, P. G. 1980. Chromosome numbers of some Southern Chukotka plant species. Bot. Zhurn. 65 (1): 51–59.

CCDB · book-ipcn67-71 — ZHUKOVA, P.G . & A.D. TIKHONOVA. 1971. Chromosome numbers of certain plant species indigenous to the Chukotsky province. (In Russian). Bot. Zurn. 56: 868-875.

CCDB · book-ipcn73-74 — ZHUKOVA, P.G., V.V. PETROVSKY, & T.N. PLIEVA. 1973. The chromosome numbers and taxonomy of some plant species from Siberia and Far East. (in Russian) Bot. zurn. (Moscow & Leningrad) 58: 1331-1342.

CCDB · eflora

TreeOfSex · plant — Goldblatt1979 ↗

2n 422×CCDB · fl-europaea · CCDB · ipcn-api-dl

CCDB · fl-europaea — Urbanska-

CCDB · ipcn-api-dl — Yurtsev, B. A. & P. G. ZHUKOVA. 1982. Chromosome numbers of some plants of the northeastern Yakutia (the drainage of the Indigirka River in its middle reaches). Bot. Zhurn. 67 (6): 778–787. (In Russian).

n 143×CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 · TreeOfSex · plant

CCDB · ipcn-api-dl — Bayer, R. J. 1984. Chromosome numbers and taxonomic notes for North American Species of Antennaria (Asteraceae: Inuleae). Syst. Bot. 9: 74–83.

CCDB · book-ipcn73-74 — POJAR, J. 1973. Levels of polyploidy in four vegetation types of southwestern British Columbia. Canad. J. Bot. 51: 621-628. I

TreeOfSex · plant — Goldblatt1979 ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 468 records

Wild obs. + sensor710

Museum / vouchered758

Range

Area of Occupancy AOO3 412 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 405≤1 km 106≤10 km 47>10 km 21

579 georeferenced · 131 without coordinates

Open the mapobservation + sensor710

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 64≤1 km 177≤10 km 153>10 km 22

416 georeferenced · 342 without coordinates

Open the institutions mapphysical evidence758

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions25 of 45 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WTUlocation not on record	107
University of Alberta Museumslocation not on record	92
Moscow, US	92
Moscow State Universitylocation not on record	64
Pullman, US	59
Missoula, US	53
Corvallis, US	37
Vancouver, CA	36
Victoria, CA	35
DOI/NPS, Mount Rainier National Parklocation not on record	32
Bronx, US	26
Bozeman, US	15
Boise, US	15
Caldwell, US	7
SLU Artdatabankenlocation not on record	6
Pocatello, US	6
Logan, US	5
Wuzhou, CN	4
Institute of the biological problems of the North FEB RASlocation not on record	4
Provo, US	4
Tromso University Museumlocation not on record	4
Tacoma, US	3
San Francisco, US	3
AUAlocation not on record	3
Cheney, US	3
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	2
University of Stellenboschlocation not on record	2
University of Lethbridgelocation not on record	2
Paris, FR	2
Université Lavallocation not on record	2
Kew, GB	2
University of British Columbia, Herbariumlocation not on record	2
University of Guelph, OAC Herbariumlocation not on record	2
NTNU University Museum, Department of Natural Historylocation not on record	2
Portland, US	1
GB	1
Riverside, US	1
Uppsala, SE	1
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	1
STNFlocation not on record	1
ASUlocation not on record	1
Musee des Dinosaures d'Esperaza (Aude)location not on record	1
Finnish Museum of Natural History, Botanical Museumlocation not on record	1
Québec, CA	1
New Brunswick, US	1

45 institutions · 744 of 758 vouchered records shown · 14 without an institution code

09Environmental DNA11 detections

Where the DNA of Antennaria lanata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.7 °C 6.20–12.5

Seasonal swing summer↔winter21.6 °C

Max temp (day)13.4 °C 7.90–20.0

Min temp (night)6.70 °C 2.50–7.80

Precipitation102 mm/mo 54.9–131

Air humidity64.4 % 55.5–72.1

Moisture balance13.3 mm/mo -92.3–66.8

Vapour deficit522 Pa 258–642

Wind speed3.60 m/s 2.70–6.20

Cloud cover63.0 % 34.1–63.5

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Antennaria lanata

At a glance

Sources11 archives

Size & morphology5

Life cycle & reproduction4

Diet & foraging1

Habitat & environment7

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 468 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions25 of 45 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 468 records