Antennaria dioica
(L.) Gaertn. · speciesAt a glance
Occurrence records177 050
Data sources15
Biological traits58
DNA specimens29
eDNA detections39
Sources15 archives
Databases and archives Antennaria dioica's data was compiled from.
WikipediaWikimedia Foundation11 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility177 050 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI39 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics29 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Tree of SexTree of Sex Consortiumgenome & karyotype↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources58 traits
Chemical compositionLOTUS13 compounds
Occurrence & distributionGBIF177 050 records
Environmental DNA2 datasets · 9 countries39 detections
DNA & barcodingBOLD · NCBI29 specimens
Genome at a glanceCCDB · GoaT · TreeOfSex1.3 Gbp
01Narrative
Antennaria dioica (mountain everlasting, stoloniferous pussytoes, catsfoot or cudweed) is a Eurasian and North American species of flowering plant in the family Asteraceae. It is a perennial herb found in cool northern and mountainous regions of Europe and northern Asia (Russia, Mongolia, Japan, Kazakhstan, China (Xinjiang, Heilongjiang, Gansu)), and also in North America in Alaska only.Flora of China Vol. 20-21 Page 789 蝶须 die xu Antennaria dioica (Linnaeus) Gaertner, Fruct. Sem. Pl. 2: 410. 1791.Flora of North America Vol. 19, 20 and 21 Page 406 Stoloniferous pussytoes Antennaria dioica (Linnaeus) Gaertner, Fruct. Sem. Pl. 2: 410. 1791.Altervista Flora Italiana, Sempiterni di montagna, Antennaria dioica (L.) Gaertn. includes photos and European distribution map
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology19
Leaf length12.5 mm
Leaf length max15 mm
Leaf length min10 mm
Leaf mass2.4 mg
Leaf size44.95 mm²
⚠ sources differ — TRY: 44.95 mm² · LEDA: 28 mm² · GIFT: 28.0 mm²
Leaf width5.5 mm
Leaf width max8 mm
Leaf width min3 mm
Plant height0.1 m
⚠ sources differ — GIFT: 0.1 m · LEDA: 0.1 m · TRY: 0.019 m
Plant height generative0.095 m
Plant height max0.3 m
Plant height min0.03 m
Seed length1.07 mm
Seed mass0.053 mg
Seed mass max0.05 mg
Seed mass min0.047 mg
Seed volume0.04 mm³
Seed volume max0.04 mm³
Seed volume min0.04 mm³
Life cycle & reproduction15
Deciduousnessevergreen
Dehiscenceindehiscent
Dispersal typehuman
⚠ sources differ — LEDA: ethelochor · GIFT: anemochorous
Flowering endAug
Flowering startMay
Life formperennial or subshrub
Life spanperennial
Lifespan years5 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formchamaephyte
Reproduction asexualpresent
Seed number280
Self fertilizationabsent
Sex typedioecious
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 700 m
Elevation mean2 550 m
Elevation min2 400 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typeachene
Growth formherb
Habitat GIFTforest, forest edges, meadows: dry, mountains, rivers, sand, stony places, tundra
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry8
Leaf C:N ratio32.04 g/g
Leaf c456 mg/g
Leaf dry-matter content (LDMC)243 mg/g
Leaf n14.47 mg/g
Leaf p1.3 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)16.63 mm²/mg
⚠ sources differ — TRY: 16.63 mm²/mg · LEDA: 18.4 mm²/mg · GIFT: 18.4 mm²/mg
Other traits1
Diaspore typefruit
03Chemical composition13 compounds
Compounds documented for Antennaria dioica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Flavones5
Cinnamic acids and derivatives2
Lupane triterpenoids1
Ursane and Taraxastane triterpenoids1
Stigmastane steroids1
Documented compounds13 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Ursolic Acid | present | LOTUS | |
| 1-Amino-2-propanol | present | LOTUS | |
| Apigenin | present | LOTUS | |
| Apigenin 4'-O-beta-D-glucopyranoside | present | LOTUS | |
| Apiumetrin | present | LOTUS | |
| beta-Sitosterol | present | LOTUS | |
| Hydroquinone | present | LOTUS | |
| hydroquinone-O-β-D-glucopyranoside | present | LOTUS | |
| Lupeol | present | LOTUS | |
| Luteolin 7-diglucoside | present | LOTUS |
05DNA & barcoding29 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antennaria dioica has left across the world's sequence archives.
At a glance
DNA specimens29
Marker genes6
GenBank sequences10
eDNA detections39
Countries9
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAAACCATTTGGTTGAGGGCACGTCTGCCTGGGCGTCACACATC …
Antennaria dioica voucher NMW2095 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK5★rbcL1★rbcLa★ITS4★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · TreeOfSex
The complete instruction manual Antennaria dioica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 300 740 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Antennaria dioica1.3 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidy4× tetraploid · measured
Chromosome records18–1002n range28median28mode83records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2867×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Tree of Sex Database · GoaT · Kew Plant DNA C-values Database +16
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Tree of Sex Database — ↗
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — URBANSKA-WORYTKIEWICZ K. - 1968. Recherches cytologiques sur les populations alpines d'Antennaria Gaertn.. Ber. Schweiz. Bot. Ges. , 78: 192-201.
CCDB · slov-fl — Májovský J. et al., 1970b: Index of chromosome numbers of Slovakian flora Part 2. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 18: 45-60.
CCDB · iapt — IAPT/IOPB Chromosome Data 9
CCDB · brit-fl — Bailey, J.P., Gornall, R.J. Irish Naturalists' J. : ()
CCDB · brit-fl — Morton, J.K. Watsonia 11: 211-223 (1977)
CCDB · brit-fl — Richards, A.J. Taxon 21: 165-166 (1972)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3978
CCDB · fl-europaea — Urbanska-
CCDB · poland — Urba?ska K. 1959. Cytology of Antennaria carpatica and A. dioica. Acta Biol. Cracov. Ser. Bot. 2, 43-49.
CCDB · book-ipcn65 — Urbanska-W. 1965; Sokolovskaya 1965
CCDB · ipcn-api-dl — Bayer, R. J. 1984. Chromosome numbers and taxonomic notes for North American Species of Antennaria (Asteraceae: Inuleae). Syst. Bot. 9: 74–83.
CCDB · ipcn-api-dl — Dmitrieva, S. A. & V. I. Parfenov. 1985. Kariologicheskaja kharakteristika nekotorykh vidov poleznykh rastenij flory Belorussii. Izv. Akad. Nauk Belorussk. SSR, Ser. Biol. Nauk 6: 3–8.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1984. In R.E. Krogulevich & T.S. Rostovtseva, Khromosomnye Chisla Tsvetkovykh Rastenii i Sibiri Dal'nego Vostoka. Izdatel'stvo "Nauka", Sibirskoe Otdelenie, Novosibirsk. ý.
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1984. Khrom. Chisla Tsvet. Nauka, Novosibirsk.
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1982. The chromosome numbers of some species of the family Apiaceae. III. Bot. Zhurn. SSSR 67 (2): 206–210. (In Russian).
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Kariologicheskij analiz vidov flory Vostochnogo Sajana. V Flora Pribajkal'ja. 19–48. Nauka, Novosibirsk.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1976. Rol poliploidii v genesise flory Putorana. In: L. I. Malyshev, ed. 1976 Flora Putorana: Materali k Poznaniiu Osobennostei Sostava i Genezisia Gornykh Subarkticheskikh Flor Sibir. Novosibirsk. Nauka, Novosibirsk
CCDB · ipcn-api-dl — Kartashova, N. N., L. A. MALAKHOVA, Koslova & N. A. Dubrova. 1974. Chisla chromosom u rjada polesnykh rastenij is prirodnykh populjacij flory Priob'ja. Biol. Biofis. Tomsk. 47–53.
CCDB · ipcn-api-dl — Baltisberger, M. 1990. Chromosomenzahlen einiger Pflanzen aus Jugoslawien. Candollea 45: 439–446.
CCDB · ipcn-api-dl — Probatova, N. S. & A. P. Sokolovskaya. 1990. Chromosome numbers in some representatives of the families Asclepiadaceae, Asteraceae, Boraginaceae, Chenopodiaceae, Lamiaceae, Oleaceae, Onagraceae, Scrophulariaceae, Solanaceae, Urticaceae from the Soviet Far East. Bot. Žhurn. (Moscow & Leningrad) 75: 1619–1622.
CCDB · ipcn-api-dl — Dmitrieva, S. A. 1986. Chisla khromosom nekotorych vidov rastenij Berezinskogo Biosfernogo Zapovednika. Zapov. Belorussii Issl. 10: 24–28.
CCDB · ipcn-api-dl — Lavrenko, A. N., N. P. Serditov & Z. G. Ulle. 1991. Chromosome numbers in some species of vascular plants from the Pechoro-Ilychsky Reservation (Komi ASSR). Bot. Žhurn. (Moscow & Leningrad) 76: 473–476.
CCDB · ipcn-api-dl — Huber, W. & M. Baltisberger. 1992. IOPB chromosome data 4. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 18/19: 6–8.
CCDB · ipcn-api-dl — Baltisberger, M. 1992. Botanische Notizen und zytologische Untersuchungen an einigen Pflanzen (insbesondere aus den Gattungen Ranunculus und Achillea) aus dem albanisch-jugoslawischen Grenzgebiet (Korab, Sar Planina). Ber. Geobot. Inst. ETH Stiftung Rübel 58: 192–211.
CCDB · ipcn-api-dl — Stepanov, N. V. 1994. Chromosome numbers of some higher plants taxa of the flora of Krasnoyarsk region. Bot. Žhurn. (Moscow & Leningrad) 79(2): 135–139.
CCDB · ipcn-api-dl — Belaeva, V. A. & V. Siplivinsky. 1981. In Chromosome number reports LXXIII. Taxon 30: 857–860.
CCDB · ipcn-api-dl — Van Loon, J. C. & B. Kieft. 1980. In Chromosome number reports LXVIII. Taxon 29: 538–542.
CCDB · ipcn-api-dl — Belaeva, V. A. & V. N. SIPLIVINSKY. 1975. Chromosome numbers and taxonomy of some species of Baikal flora. Bot. Žhurn. (Moscow & Leningrad) 60(6): 864–872.
CCDB · ipcn-api-dl — SCHOLTE, G. 1977. In IOPB chromosome number reports LVI. Taxon 26: 257–274.
CCDB · ipcn-api-dl — ZHUKOVA, P. G., A. A. KOROBKOV & A. D. TIKHONOVA. 1977. Chromosome numbers of some plant species in the eastern Arctic Yakuta. Bot. Žhurn. (Moscow & Leningrad) 62(2): 229–234.
CCDB · ipcn-api-dl — Dmitrieva, S. A., V. I. Parfenov & I. V. SCHVEC. 1977. The karyological characterization of some species of the Belorussian flora. Vesci Akad. Navuk Belarusk SSR Ser. Bi jal. Sel'skagasp. Navuk. 19: 82–91.
CCDB · ipcn-api-dl — KARTASHOVA, N. N., L. A. MALAKHOVA & A. A. KOZLOVA. 1974. Study of the chromosomes of the representatives of the Ob region flora. I. Number of chromosomes of the Tomsk district. Naucn. Dokl. Vyss. Shkoly, Biol. Nauki 4: 114–119.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1976. Chromosome numbers of plant species from the Tunkinsky Alpes (East Sayan). News Sib. Depart. Acad. Sci. USSR, Ser. Biol. 15(3): 46–52.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Karyological analysis of the species of the flora of eastern Sayana. Pp. 19-48 in L. I. Malyshev & G. A. Peshlcova (eds.) Flora of the Prebaikal. Novosibirsk.
CCDB · ipcn-api-dl — Chmielewski, J. G. & C. C. Chinnappa. 1988. The genus Antennaria (Asteraceae: Inuleae) in western North America. II. Additional chromosome counts. Rhodora 90: 133–137.
CCDB · ipcn-api-dl — Bayer, R. J. 1988. Patterns of isozyme variation in western North American Antennaria (Asteraceae: Inuleae). I. Sexual species of sect. Dioicae. Syst. Bot. 13: 525–537.
+25 more references
2n 425×CCDB · ipcn-api-dl · TreeOfSex · plant
CCDB · ipcn-api-dl — Chinnappa, C. C. 1986. Chromosome numbers in Antennaria (Asteraceae: Inuleae) from western North America. Canad. J. Genet. Cytol. 28: 468–475.
CCDB · ipcn-api-dl — Chinnappa, C. C. 1984. Triploidy in the genus Antennaria (Asteraceae: Inuleae). Canad. J. Genet. Cytol. 26: 133–136.
TreeOfSex · plant — Goldblatt1979 ↗
2n 263×CCDB · book-fedorov
CCDB · book-fedorov — Holmgren 1919
CCDB · book-fedorov — Tischler 1934
CCDB · book-fedorov — Bergman 1935b
2n 563×CCDB · ipcn-api-dl · CCDB · book-fedorov
CCDB · ipcn-api-dl — Bayer, R. J. & G. L. STEBBINS. 1987. Chromosome numbers, patterns of distribution, and apomixis in Antennaria (Asteraceae: Inuleae). Syst. Bot. 12: 305–319.
CCDB · ipcn-api-dl — Chmielewski, J. G. & C. C. Chinnappa. 1990. The genus Antennaria (Asteraceae: Inuleae) in Arctic North America: chromosome numbers and taxonomic notes. Rhodora 92: 264–276.
CCDB · book-fedorov — Jorgensen et al. 1958
2n 843×GoaT · Tree of Sex Database · CCDB · ipcn-api-dl · TreeOfSex · plant
2n 181×CCDB · iapt
CCDB · iapt — IAPT/IOPB Chromosome Data 30
2n 1001×CCDB · book-ipcn66
CCDB · book-ipcn66 — Mosquin & Hayley 1966
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Ivanova, D, Vladimirov, V & Bancheva, S. (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1795-1796
n 141×CCDB · iber-fl
CCDB · iber-fl — Nouvelles prospections caryologiques dans la flore orophile des Pyrnes et de la Sierra Nevada. Kpfer, P.Bull. Soc. Neuchteloise Sci. Nat.91: 87-104(1968).
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
polyploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
07Deep time~2.21 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin2.21 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type177 050 records
Wild obs. + sensor166 259
Museum / vouchered9 987
Cultivated / captive59
Other745
Origin
Native6 559
Introduced4
Range
Area of Occupancy AOO274 372 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy62% within 1 km
≤100 m 53 280≤1 km 34 648≤10 km 52 223>10 km 2 361
142 512 georeferenced · 23 747 without coordinates
Open the mapobservation + sensor166 259
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy48% within 1 km
≤100 m 836≤1 km 2 300≤10 km 2 876>10 km 550
6 562 georeferenced · 3 425 without coordinates
Open the institutions mapphysical evidence9 987
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy19% within 1 km
≤1 km 4≤10 km 4>10 km 13
21 georeferenced · 38 without coordinates
Open the mapnot free-living59
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions85 of 175 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Moscow State Universitylocation not on record | 734 |
| Uniwersytet Wrocławskilocation not on record | 687 |
| Kuopio, FI | 679 |
| LDlocation not on record | 654 |
| Olocation not on record | 466 |
| TROMlocation not on record | 385 |
| Trondheim, NO | 359 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 335 |
| Oskarshamn, SE | 295 |
| Oulu, FI | 250 |
| Salzburg, AT | 248 |
| Bergen, NO | 240 |
| Turku, FI | 214 |
| BIO-UNIPIlocation not on record | 202 |
| BFLlocation not on record | 193 |
| Jyväskylä, FI | 182 |
| SLU Artdatabankenlocation not on record | 169 |
| KMNlocation not on record | 167 |
| Zürich, CH | 146 |
| Barcelona, ES | 113 |
| MeiseBGlocation not on record | 113 |
| BDBClocation not on record | 113 |
| South Kensington, GB | 105 |
| Tartu, EE | 103 |
| TUR-Alocation not on record | 101 |
| IFR-DNFlocation not on record | 82 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 74 |
| LfUlocation not on record | 61 |
| Uppsala, SE | 61 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 58 |
| Tallinn, EE | 52 |
| Görlitz, DE | 50 |
| Zürich, CH | 50 |
| Bern, CH | 49 |
| Adam Mickiewicz University in Poznańlocation not on record | 45 |
| Helsinki, FI | 45 |
| BRNUlocation not on record | 45 |
| Entomological Society of Latvialocation not on record | 44 |
| Brussel, BE | 42 |
| BClocation not on record | 41 |
| Porvoo, FI | 36 |
| València, ES | 35 |
| Vitoria, ES | 32 |
| Stockholm, SE | 29 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 29 |
| Frankfurt am Main | 27 |
| Beijing, CN | 26 |
| Wlocation not on record | 25 |
| Provincia di Livornolocation not on record | 22 |
| San Sebastián, ES | 21 |
| MAlocation not on record | 20 |
| WTUlocation not on record | 20 |
| No collectionlocation not on record | 20 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 20 |
| GJOlocation not on record | 19 |
| Rovaniemi, FI | 19 |
| Urumqi, CN | 19 |
| Salamanca, ES | 17 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 17 |
| Kandalaksha State Nature Reservelocation not on record | 16 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 16 |
| Mlocation not on record | 14 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 14 |
| Natural History Museum Rotterdamlocation not on record | 12 |
| IWEP FEB RASlocation not on record | 12 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 12 |
| Porrentruy, CH | 11 |
| nbflocation not on record | 11 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 11 |
| Berlin, DE | 10 |
| Dresden, DE | 10 |
| BSBIlocation not on record | 8 |
| GZUlocation not on record | 8 |
| Department of Bacteriology, University of Wisconsinlocation not on record | 7 |
| UGentlocation not on record | 7 |
| Glarus, CH | 7 |
| Madrid, ES | 6 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 6 |
| Paris, FR | 6 |
| Frauenfeld, CH | 6 |
| Badajoz, ES | 6 |
| Boise, US | 5 |
| Forssa, FI | 5 |
| Bronx, US | 5 |
| Bourges, FR | 5 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 5 |
| Christchurch, NZ | 5 |
| Granada, ES | 5 |
| Logan, US | 5 |
| CICYTEXlocation not on record | 5 |
| College of the Atlantic, Museumlocation not on record | 5 |
| Alicante, ES | 5 |
| PRClocation not on record | 5 |
| Durham, US | 5 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 5 |
| Sion, CH | 4 |
| Anchorage, US | 4 |
| CJBGlocation not on record | 4 |
| University of Stellenboschlocation not on record | 4 |
| Philadelphia, US | 4 |
| Podgorica, ME | 4 |
| Saint Louis, US | 4 |
| Palacký University in Olomouclocation not on record | 4 |
| Pamplona, ES | 4 |
| Göteborg, SE | 4 |
| Provo, US | 4 |
| Tromso University Museumlocation not on record | 4 |
| DBF-NHMDlocation not on record | 4 |
| Uniwersytet Śląski w Katowicachlocation not on record | 4 |
| Xiamen, CN | 4 |
| Universität Erlangen-Nürnberglocation not on record | 3 |
| Tilburg, NL | 3 |
| Chongqing Museumlocation not on record | 3 |
| H-Wolflocation not on record | 3 |
| Gijón, ES | 3 |
| Pamplona, ES | 3 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| Bloomington, US | 3 |
| Mississippi State, US | 3 |
| Bangkok, TH | 3 |
| Kew, GB | 3 |
| NMBU:MINAlocation not on record | 3 |
| Universität Basel, Herbariumlocation not on record | 3 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 3 |
| Monastir, TN | 2 |
| Santa Barbara, US | 2 |
| Denver, US | 2 |
| CASlocation not on record | 2 |
| BG-NMNHSlocation not on record | 2 |
| Uniwersytet Opolskilocation not on record | 2 |
| St. Paul, US | 2 |
| inatura Erlebnis Naturschau GmbHlocation not on record | 2 |
| H-AkrKGlocation not on record | 2 |
| Muséum Henri Lecoqlocation not on record | 2 |
| Institute of the biological problems of the North FEB RASlocation not on record | 2 |
| Komarov Botanical Institutelocation not on record | 2 |
| Moscow, US | 2 |
| H-Schuhwlocation not on record | 2 |
| SZUlocation not on record | 1 |
| Herb. BBGlocation not on record | 1 |
| Hokkaido University Museumlocation not on record | 1 |
| Arequipa, PE | 1 |
| Davis, US | 1 |
| SWlocation not on record | 1 |
| Davenport, US | 1 |
| Wellington, NZ | 1 |
| EL PASO, US | 1 |
| Dekalb, US | 1 |
| Wuzhou, CN | 1 |
| Riverside, US | 1 |
| ULBF-AGRlocation not on record | 1 |
| Whitehorse, CA | 1 |
| Urumqi, CN | 1 |
| Banyoles, ES | 1 |
| Toronto, CA | 1 |
| IPE-CSIClocation not on record | 1 |
| National Museum Waleslocation not on record | 1 |
| Plocation not on record | 1 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 1 |
| Servico de Microbiologia e Imunologialocation not on record | 1 |
| CBDClocation not on record | 1 |
| Chengdu, CN | 1 |
| Uniwersytet Warszawskilocation not on record | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Tsukuba, JP | 1 |
| Sevilla, ES | 1 |
| UoB-IBlocation not on record | 1 |
| Dhaka, BD | 1 |
| National Institute of Biological Resourceslocation not on record | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| Sant Julià de Lòria, AD | 1 |
| ROM007location not on record | 1 |
| Umeå Universitylocation not on record | 1 |
| Auckland, NZ | 1 |
175 institutions · 8 960 of 9 987 vouchered records shown · 1 005 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA39 detections
Where the DNA of Antennaria dioica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found39
Studies independent surveys2
Countries9
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 39 detections have coordinates
Open the map9 countries0
on rocky outcrop
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median11.5 °C 7.50–14.1
Seasonal swing summer↔winter19.5 °C
Max temp (day)16.0 °C 9.70–17.3
Min temp (night)5.70 °C 4.20–9.70
Precipitation172 mm/mo 55.1–294
Air humidity62.1 % 59.0–69.1
Moisture balance53.5 mm/mo -45.9–164
Vapour deficit515 Pa 334–649
Wind speed3.30 m/s 2.60–5.00
Cloud cover35.8 % 35.8–63.6
CHELSA 1981–2010, ~9 km grid, at location & month of 35 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.