Antennaria aromatica

Evert · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Antennaria

At a glance

Occurrence records113

Data sources12

Biological traits7

DNA specimens10

eDNA detections5

Sources12 archives

Databases and archives Antennaria aromatica's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility113 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Occurrence & distributionGBIF113 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD · NCBI10 specimens

Genome at a glanceCCDB · GoaT · TreeOfSex2n = 28

01Narrative

Antennaria aromatica, the scented pussytoes, is a North American species of plants in the family Asteraceae. It is native to the Rocky Mountains of Alberta, Montana, Idaho, and Wyoming.Biota of North America Program 2014 county distribution mapJ.G.Chmielewski & C.C.Chinnappa. 1988. Sida 13:256-258 The crushed foliage has a strong scent resembling that of citronella.Flora of North America Vol. 19, 20 and 21 Page 408 Scented or aromatic pussytoes, Antennaria aromatica Evert, Madroño. 31: 109, fig. 1. 1984.Evert, Erwin F. 1984. Madroño 31(2): 109–111, figure 1

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antennaria aromatica has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes4

GenBank sequences10

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSL40773.1 ↗246 bp

ACGT

CCCTGCAAAGCGAACGACCCGTGAACATGTAACTACAACCGGTCAACTTAGGGATTGAGCGTTTGTTTGATCCTTAGTTGCCCTTGTCGA …

Antennaria aromatica internal transcribed spacer

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL5★rbcLa★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · TreeOfSex

The complete instruction manual Antennaria aromatica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidypolyploid inferred

Chromosome records28–562n range28median28mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 283×GoaT · Tree of Sex Database · CCDB · ipcn-api-dl · TreeOfSex · plant

GoaT · Tree of Sex Database — ↗

CCDB · ipcn-api-dl — Evert, E. F. 1984. **** DUPLICATE RECORD ****.

TreeOfSex · plant — Goldblatt1979 ↗

2n 561×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Bayer, R. J. & G. L. STEBBINS. 1987. Chromosome numbers, patterns of distribution, and apomixis in Antennaria (Asteraceae: Inuleae). Syst. Bot. 12: 305–319.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type113 records

Wild obs. + sensor8

Museum / vouchered105

Range

Area of Occupancy AOO328 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 2≤10 km 1>10 km 1

4 georeferenced · 4 without coordinates

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 1≤1 km 14≤10 km 13

28 georeferenced · 77 without coordinates

Open the institutions mapphysical evidence105

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Missoula, US	45
University of Alberta Museumslocation not on record	14
Bronx, US	10
Logan, US	8
WTUlocation not on record	7
Centre for Biodiversity Genomicslocation not on record	4
Pullman, US	3
Riverside, US	2
Moscow, US	2
Bozeman, US	2
University of Lethbridgelocation not on record	1
Denver, US	1
Wuzhou, CN	1
University of Stellenboschlocation not on record	1
DOI/NPS, Colonial National Historical Parklocation not on record	1

15 institutions · 102 of 105 vouchered records shown · 3 without an institution code

09Environmental DNA5 detections

Where the DNA of Antennaria aromatica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

rock crevices at top of ridgefriable limstone about 50ft short of the sum…exposed rocky slope above tree linemountain slope and peak equidistant b/w Pyri…alpine tundra on calcareous formation

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.8 °C 11.0–14.4

Seasonal swing summer↔winter24.3 °C

Max temp (day)20.9 °C 18.0–21.9

Min temp (night)6.90 °C 4.90–7.50

Precipitation66.0 mm/mo 60.2–115

Air humidity50.1 % 47.7–54.2

Moisture balance-96.2 mm/mo -97.0–-8.00

Vapour deficit832 Pa 617–842

Wind speed2.60 m/s 2.50–3.10

Cloud cover24.9 % 23.8–31.9

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)