Antennablennius hypenetes

Animalia/Chordata/Perciformes/Blenniidae/Antennablennius

At a glance

Occurrence records41

Data sources8

Biological traits4

DNA specimens4

eDNA detections0

Sources8 archives

Databases and archives Antennablennius hypenetes's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility29 records↗

OBISOcean Biodiversity Information System12 records↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS41 records

DNA & barcodingBOLD4 specimens

01Narrative

Antennablennius hypenetes, the Arabian blenny, is a species of combtooth blenny found in the western Indian ocean, from the northern Red Sea to the Persian Gulf.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length6.5 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Other traits1

Vulnerability10

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antennablennius hypenetes has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

CCTTTATTTAGTATTTGGTGCCTGAGCAGGAATAGTGGGAACCGCTTTAAGCCTACTAATCCGGGCGGAGCTAAGCCAGCCAGGGGCTTT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Antennablennius simonyisame genus13.0%Antennablennius bifilumsame genus13.7%Alloblennius pictussame family15.5%Hemiramphus depauperatussame order16.3%Hyporhamphus quoyisame order17.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5P

animal barcode

08Occurrence & distribution

Record type41 records

Wild obs. + sensor12

Museum / vouchered29

Range

Area of Occupancy AOO80 km²

Depth

0–200 m sunlit3

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 1.5 m · max 2 m · 3 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 6

9 georeferenced · 3 without coordinates

Open the mapobservation + sensor12

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 6

6 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence29

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Frankfurt am Main	11
Paris, FR	5
Honolulu, US	1

3 institutions · 17 of 29 vouchered records shown