Antedon bifida

(Pennant, 1777) · species

image placeholder — illustration coming later

Animalia/Echinodermata/Crinoidea/Comatulida/Antedonidae/Antedon

At a glance

Occurrence records16 654

Data sources11

Biological traits4

DNA specimens7

eDNA detections7

Sources11 archives

Databases and archives Antedon bifida's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 972 records↗

OBISOcean Biodiversity Information System8 682 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Paleobiology DatabasePBDB consortiumfossil record↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS16 654 records

Environmental DNA3 datasets · 2 countries7 detections

DNA & barcodingBOLD7 specimens

Genome at a glanceGoaT · NCBI≈320 Mbp

01Narrative

Antedon bifida, the common feather star. The Garvellachs, western Scotland, UK. Antedon bifida is a species of crinoid in the family Antedonidae commonly known as the rosy feather star. It is found in north west Europe.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

Other traits2

Depth max200 m

Depth min5 m

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antedon bifida has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes4

eDNA detections7

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P619 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.11%

Haplotypes1

BIN1

Where individuals differ — all 1 variable positions, in barcode order

548Gvariable

TTGGTGCTTGGGCTGGTATGTTAGGTACAGCATTGAGTATAATAATTCGTATGGAGTTAGCTCAACCTGGCTCTTTTTTAGGAGATGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Antedon mediterraneasame genus2.9%Antedon irissame genus10.7%Heliometra glacialissame family11.5%Florometra serratissimasame family11.8%Promachocrinus kerguelensissame family12.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S18S28S

animal barcoderibosomalmarker

06Genome at a glanceGoaT · NCBI

The complete instruction manual Antedon bifida carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈319 614 875 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Antedon bifida0.32 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 8 n = 4

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 81×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness95.1% BUSCO

08Occurrence & distribution

Record type16 654 records

Wild obs. + sensor8 336

Museum / vouchered7 173

Other1 145

Range

Area of Occupancy AOO10 568 km²

Depth

0–200 m sunlit5 934

200–1000 m twilight8

1–4 km midnight0

>4 km abyssal0

median 17.3 m · max 509.5 m · 5 942 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 7 193≤1 km 58≤10 km 39>10 km 6

7 296 georeferenced · 1 040 without coordinates

Open the mapobservation + sensor8 336

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy90% within 1 km

≤100 m 196≤1 km 52≤10 km 18>10 km 11

277 georeferenced · 6 896 without coordinates

Open the institutions mapphysical evidence7 173

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DASSHlocation not on record	176
PNHSlocation not on record	39
730location not on record	28
CEFASlocation not on record	17
South Kensington, GB	9
ARMS-MBONlocation not on record	5
Paris, FR	3
Natural History Museum Rotterdamlocation not on record	3
Cambridge, US	2
Citadel Hill, GB	2
486location not on record	2
Institut Francais pour l'Etude de la Merlocation not on record	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Santa Barbara Museum of Natural Historylocation not on record	1
BioFokuslocation not on record	1
CASlocation not on record	1
Natural History Museum, Londonlocation not on record	1
Brussels, BE	1
Frankfurt am Main	1
MZLUlocation not on record	1

20 institutions · 296 of 7 173 vouchered records shown · 2 without an institution code

09Environmental DNA7 detections

Where the DNA of Antedon bifida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys3

Countries2

Verifiable raw sequence linked5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

Industrial port; industrial; 9.4 - Subtidal …Marina pontoonMarina; semi-industrial; 9.5 - Subtidal Sand…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 14.8–18.7

Seasonal swing summer↔winter9.80 °C

Max temp (day)20.2 °C 16.5–22.2

Min temp (night)14.5 °C 12.3–15.4

Precipitation74.8 mm/mo 48.9–91.7

Air humidity62.2 % 61.7–64.6

Moisture balance-69.7 mm/mo -106–-22.9

Vapour deficit732 Pa 600–824

Wind speed3.30 m/s 3.30–6.00

Cloud cover38.8 % 34.7–53.3

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Antedon bifida

At a glance

Sources11 archives

Habitat & environment2

Other traits2

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type16 654 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type16 654 records